WormBase Tree Display for Variation: WBVar00250286

WBVar00250286 Name: Public_name: tm1280
    Other_name: Y111B2A.22a.1:c.1401+146_1688del
      Y111B2A.22d.1:c.963+146_1250del
      Y111B2A.22b.1:c.1401+146_1688del
    HGVSg: CHROMOSOME_III:g.12718938_12719728del
  Sequence_details: SMap: S_parent: Sequence: Y111B2A
    Flanking_sequences: cccaaatttccagctaaaatctcaaatttt ggttggattggattggatggttacacttta
    Mapping_target: Y111B2A
    Source_location: 7 CHROMOSOME_III 12718937 12719729 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1280_external
      tm1280_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1280
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007027
    Transcript: Y111B2A.22b.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y111B2A.22b.1:c.1401+146_1688del
        cDNA_position: ?-1688
        CDS_position: ?-1688
        Protein_position: ?-563
        Intron_number: 4/9
        Exon_number: 5/10
      Y111B2A.22a.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y111B2A.22a.1:c.1401+146_1688del
        cDNA_position: ?-1710
        CDS_position: ?-1688
        Protein_position: ?-563
        Intron_number: 5/18
        Exon_number: 6/19
      Y111B2A.22d.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y111B2A.22d.1:c.963+146_1250del
        cDNA_position: ?-1250
        CDS_position: ?-1250
        Protein_position: ?-417
        Intron_number: 2/14
        Exon_number: 3/15
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000058 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. W.G. Kelly to the National Bioresource Project of Japan: homozygous animals hatch but arrest as somewhat Unc late-stage (L3/L4) larvae. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. W.G. Kelly to the National Bioresource Project of Japan: homozygous animals hatch but arrest as somewhat Unc late-stage (L3/L4) larvae. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 226048/226049-226839/226840 (791 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele