WormBase Tree Display for Variation: WBVar00249848

WBVar00249848 Name: Public_name: tm821
  Sequence_details: SMap: S_parent: Sequence: C24H11
    Flanking_sequences: ttatccgattttcagagcctttcgaccaac taaaaactacatttcaagctcattttcagc
    Mapping_target: C24H11
    Source_location: 7 CHROMOSOME_III 11776951 11777598 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: A
      Deletion
    PCR_product: tm821_external
      tm821_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 821
    NBP_allele
    Status: Live
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as 'homozygous viable' by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. A. van der Bliek: Normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. A. van der Bliek: Hermaphrodites are fertile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000057 PATO:0000460 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson712
      WBPhenotype:0001401 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. A. van der Bliek: WT mitochondria in muscle. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0003675 PATO:0000460 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson712
  Remark: 10047/10048-A-10693/10694 (646 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele