WormBase Tree Display for Variation: WBVar00249781
expand all nodes | collapse all nodes | view schema
WBVar00249781 | Name | Public_name | tm752 | |||||
---|---|---|---|---|---|---|---|---|
Other_name (12) | ||||||||
HGVSg | CHROMOSOME_I:g.4084525_4085055del | |||||||
Sequence_details | SMap | S_parent | Sequence | C24G7 | ||||
Flanking_sequences | gtgtggagaatgacattaacttgaatgggg | caccaactctcacaccagaagtaacaatca | ||||||
Mapping_target | C24G7 | |||||||
Source_location | 7 | CHROMOSOME_I | 4084524 | 4085056 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm752_external | |||||||
tm752_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 752 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006820 | ||||||
Transcript (12) | ||||||||
Interactor | WBInteraction000009109 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. G. Benian: J. Muscle Res Cell Motii. 26, 435 (2005). Mol. Biol Cell 19, 2424 (2008). | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Remark | 59474/59475-60005/60006 (531 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Old Mapping_target C09D1 updated based on the VEP analysis pipeline to C24G7. | ||||||||
Method | NBP_knockout_allele |