WormBase Tree Display for Variation: WBVar00249781

WBVar00249781 Name: Public_name: tm752
    Other_name (12)
    HGVSg: CHROMOSOME_I:g.4084525_4085055del
  Sequence_details: SMap: S_parent: Sequence: C24G7
    Flanking_sequences: gtgtggagaatgacattaacttgaatgggg caccaactctcacaccagaagtaacaatca
    Mapping_target: C24G7
    Source_location: 7 CHROMOSOME_I 4084524 4085056 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm752_external
      tm752_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 752
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006820
    Transcript (12)
    Interactor: WBInteraction000009109
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. G. Benian: J. Muscle Res Cell Motii. 26, 435 (2005). Mol. Biol Cell 19, 2424 (2008). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 59474/59475-60005/60006 (531 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target C09D1 updated based on the VEP analysis pipeline to C24G7.
  Method: NBP_knockout_allele