WormBase Tree Display for Variation: WBVar00249747

WBVar00249747 Name: Public_name: tm717
    Other_name: CE32505:p.Asn149PhefsTer4
      T28B8.5.1:c.445_622del
    HGVSg: CHROMOSOME_I:g.8140798_8141703del
  Sequence_details: SMap: S_parent: Sequence: T28B8
    Flanking_sequences: tatcttgatctgttctcatcaccatacgaa atactgtttttcgttaagtctttcagaata
    Mapping_target: T28B8
    Source_location: 7 CHROMOSOME_I 8140797 8141704 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm717_external
      tm717_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 717
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00012116
    Transcript: T28B8.5.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000072 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal body size/shape. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000531 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal development. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000673 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal brood size. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 9832/9833-10738/10739 (906 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele