WormBase Tree Display for Variation: WBVar00249703

WBVar00249703 Name: Public_name: tm671
    HGVSg: CHROMOSOME_IV:g.627380_628364del
  Sequence_details: SMap: S_parent: Sequence: C05G6
    Flanking_sequences: acaacattttccctgacctacagtaacccg cacagtgccagatccccttttcgttgctcc
    Mapping_target: C05G6
    Source_location: 7 CHROMOSOME_IV 627379 628365 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm671_external
      tm671_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 671
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00015497
    Transcript: C05G6.1.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 2-3/10
        Exon_number: 1-3/11
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000661 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: solitary social feeding. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000640 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: normal egg-laying. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: fertile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 8533/8534-9518/9519 (985 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele