WormBase Tree Display for Variation: WBVar00249372
expand all nodes | collapse all nodes | view schema
WBVar00249372 | Name | Public_name | tm324 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F20C5.2a.1:c.1815_1938+148del | |||||||
F20C5.11.2:c.-549_-426+148del | ||||||||
HGVSg | CHROMOSOME_IV:g.8758672_8759033del | |||||||
Sequence_details | SMap | S_parent | Sequence | F20C5 | ||||
Flanking_sequences | aaaatgagaaaaggaacaactgaattggac | aatggtgttgacgaattagaagaagttgat | ||||||
Mapping_target | F20C5 | |||||||
Source_location | 7 | CHROMOSOME_IV | 8758671 | 8759034 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm324_external | |||||||
tm324_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00036431 | |||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 324 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00303015 | ||||||
WBGene00002222 | ||||||||
Transcript | F20C5.2a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F20C5.2a.1:c.1815_1938+148del | |||||||
cDNA_position | 1885-? | |||||||
CDS_position | 1815-? | |||||||
Protein_position | 605-? | |||||||
Intron_number | 10-11/14 | |||||||
Exon_number | 10-11/15 | |||||||
F20C5.11.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F20C5.11.2:c.-549_-426+148del | |||||||
cDNA_position | 1815-? | |||||||
Intron_number | 9-10/19 | |||||||
Exon_number | 9-10/20 | |||||||
Interactor | WBInteraction000052367 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Mapping_data | In_multi_point | 4465 | ||||||
Description | Phenotype (7) | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as 'homozygous viable' by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000625 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. K. Shen to the National Bioresource Project of Japan: normal synapse formation as determined by RAB-3 and CCB-1 localization to presynaptic sites in HSNL. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | TV | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. C. Bargmann to the National Bioresource Project of Japan: locomotion OK. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Dr. C. Bargmann: locomotion OK. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Comment from Dr.C. Bargmann: locomotion OK | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | TV | |||||||
WBPhenotype:0000663 | Paper_evidence | WBPaper00024501 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001225 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. H. Sawa: 0% Psa. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | TV | |||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00024501 | ||||||
Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. M.M. Barr to the National Bioresource Project of Japan: Dyf+. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | PT | |||||||
Based on normal dye filling. | Paper_evidence | WBPaper00024501 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00024501 | |||||||
WBPaper00028448 | ||||||||
WBPaper00029016 | ||||||||
WBPaper00065813 | ||||||||
Remark | 15970/15971-16332/16333 (362 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |