WormBase Tree Display for Variation: WBVar00249372
expand all nodes | collapse all nodes | view schema
WBVar00249372 | Name (3) | ||||||||
---|---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | F20C5 | |||||
Flanking_sequences | aaaatgagaaaaggaacaactgaattggac | aatggtgttgacgaattagaagaagttgat | |||||||
Mapping_target | F20C5 | ||||||||
Source_location | 7 | CHROMOSOME_IV | 8758671 | 8759034 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm324_external | ||||||||
tm324_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00036431 | ||||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 324 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00303015 | |||||||
WBGene00002222 | |||||||||
Transcript | F20C5.2a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F20C5.2a.1:c.1815_1938+148del | ||||||||
cDNA_position | 1885-? | ||||||||
CDS_position | 1815-? | ||||||||
Protein_position | 605-? | ||||||||
Intron_number | 10-11/14 | ||||||||
Exon_number | 10-11/15 | ||||||||
F20C5.11.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,5_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F20C5.11.2:c.-549_-426+148del | ||||||||
cDNA_position | 1815-? | ||||||||
Intron_number | 9-10/19 | ||||||||
Exon_number | 9-10/20 | ||||||||
Interactor | WBInteraction000052367 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | IV | |||||||
Mapping_data | In_multi_point | 4465 | |||||||
Description | Phenotype | WBPhenotype:0000615 | Paper_evidence | WBPaper00028448 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | CEM cilia adopt an inward trajectory, rather than an outward bend. | Paper_evidence | WBPaper00028448 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005246 | PATO:0000460 | Paper_evidence | WBPaper00028448 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000649 | Paper_evidence | WBPaper00028448 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Single mutants exhibit slight but significant reduction of response and vulva location efficiencies. | Paper_evidence | WBPaper00028448 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00028448 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | In a stark contrast to wild type, all IFT mutants examined abnormally accumulate PKD-2::GFP in the ciliary base and in the cilium for those mutants with ciliary axonemes. | PKD-2 accumulation is observed at the ciliary base and along the ciliary membrane. | Paper_evidence | WBPaper00028448 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000881 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. M.M. Barr to the National Bioresource Project of Japan: PKD-2::GFP localization: subtle ciliary mislocalization. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | PT | ||||||||
WBPhenotype:0000884 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. P. Sengupta to the National Bioresource Project of Japan: 10% of animals fail to dye-fill one AWB neuron when grown at 25C. Other neurons dye-fill normally. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | PY | ||||||||
Penetrance | Low | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Range | 10 | 10 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005671 | PATO:0000460 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001231 | Person_evidence | WBPerson563 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Acceleration of the rate of intraflagellar transport along the initial segment of amphid channel sensory cilia. | Person_evidence | WBPerson563 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0004030 | Paper_evidence | WBPaper00028448 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Single mutants exhibit slight but significant reduction of response and vulva location efficiencies. | Paper_evidence | WBPaper00028448 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as 'homozygous viable' by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0000625 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. K. Shen to the National Bioresource Project of Japan: normal synapse formation as determined by RAB-3 and CCB-1 localization to presynaptic sites in HSNL. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | TV | ||||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. C. Bargmann to the National Bioresource Project of Japan: locomotion OK. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Dr. C. Bargmann: locomotion OK. | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
Comment from Dr.C. Bargmann: locomotion OK | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | TV | ||||||||
WBPhenotype:0000663 | Paper_evidence | WBPaper00024501 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001225 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. H. Sawa: 0% Psa. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | TV | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00024501 | |||||||
Person_evidence | WBPerson7743 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. M.M. Barr to the National Bioresource Project of Japan: Dyf+. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | PT | ||||||||
Based on normal dye filling. | Paper_evidence | WBPaper00024501 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00024501 | ||||||||
WBPaper00028448 | |||||||||
WBPaper00029016 | |||||||||
WBPaper00065813 | |||||||||
Remark | 15970/15971-16332/16333 (362 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |