WormBase Tree Display for Variation: WBVar00249286

WBVar00249286 Name: Public_name: tm232
    Other_name: C30A5.7b.1:c.54+449_55-650delinsTTATT
    HGVSg: CHROMOSOME_III:g.8215417_8215794delinsAATAA
  Sequence_details: SMap: S_parent: Sequence: C30A5
    Flanking_sequences: ctatgctaacaactgataataaattacata gttatcatatgattggatcattctaaagaa
    Mapping_target: C30A5
    Source_location: 7 CHROMOSOME_III 8215416 8215795 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: AATAA
      Deletion
    PCR_product: tm232_external
      tm232_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 232
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006818
    Transcript: C30A5.7b.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: C30A5.7b.1:c.54+449_55-650delinsTTATT
        Intron_number: 2/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as 'homozygous viable' by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 12494/12495-AATAA-12872/12873 (378 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele