WormBase Tree Display for Variation: WBVar00249152
expand all nodes | collapse all nodes | view schema
| WBVar00249152 | Name | Public_name | t1587 | ||||
|---|---|---|---|---|---|---|---|
| Other_name | ZK688.9.1:c.166-1G>A | ||||||
| HGVSg | CHROMOSOME_III:g.7882717C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | ZK688 | |||
| Flanking_sequences | aagtttcaactcccggtcatatttgcattt | tgttgaatgaacacatttaggcaagagcat | |||||
| Mapping_target | ZK688 | ||||||
| Type_of_mutation | Substitution | c | t | ||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00051679 | ||||||
| Laboratory | GE | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00000806 | |||||
| WBGene00022803 | |||||||
| Transcript | ZK688.9.1 | VEP_consequence | splice_acceptor_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | ZK688.9.1:c.166-1G>A | ||||||
| Intron_number | 2/6 | ||||||
| Isolation | Mutagen | EMS | |||||
| Genetics | Interpolated_map_position | III | -0.511928 | ||||
| Description | Phenotype | WBPhenotype:0000773 | Paper_evidence | WBPaper00003469 | |||
| Curator_confirmed | WBPerson557 | ||||||
| WBPhenotype:0001165 | Paper_evidence | WBPaper00003469 | |||||
| Curator_confirmed | WBPerson557 | ||||||
| Remark | Sometimes multiple female pronuclei. | Paper_evidence | WBPaper00003469 | ||||
| Curator_confirmed | WBPerson557 | ||||||
| Reference | WBPaper00003469 | ||||||
| Remark | alt_det = c to t | Curator_confirmed | WBPerson51134 | ||||
| Variation information submitted by WBPerson154 on 2022-03-23_19:22:35 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||||
| Method | Substitution_allele |
