WormBase Tree Display for Variation: WBVar00249107
expand all nodes | collapse all nodes | view schema
WBVar00249107 | Evidence | Paper_evidence | WBPaper00005320 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | t1465 | |||||
Other_name | F58A4.8.1:c.1202C>T | ||||||
CE00224:p.Ala401Val | |||||||
HGVSg | CHROMOSOME_III:g.9626810G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | F58A4 | |||
Flanking_sequences | ccaaatacgacaaactacgatcaaagagag | cttcatcgacaagtttgaaaagattgacaa | |||||
Mapping_target | F58A4 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00005320 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00007802 | ||||||
Laboratory | GE | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006540 | |||||
Transcript | F58A4.8.1 (12) | ||||||
Interactor | WBInteraction000501449 | ||||||
Genetics | Interpolated_map_position | III | 0.803523 | ||||
Mapping_data | In_multi_point | 4723 | |||||
Description | Phenotype | WBPhenotype:0000628 | Paper_evidence | WBPaper00003469 | |||
Curator_confirmed | WBPerson557 | ||||||
WBPhenotype:0000766 | Paper_evidence | WBPaper00003469 | |||||
Curator_confirmed | WBPerson557 | ||||||
Remark | Sometimes centrosomal-pronuclear complex fails to center and rotate. | Paper_evidence | WBPaper00003469 | ||||
Curator_confirmed | WBPerson557 | ||||||
WBPhenotype:0001152 | Paper_evidence | WBPaper00003469 | |||||
Curator_confirmed | WBPerson557 | ||||||
Remark | No fast phase of female pronuclear migration. | Paper_evidence | WBPaper00003469 | ||||
Curator_confirmed | WBPerson557 | ||||||
WBPhenotype:0001353 | Paper_evidence | WBPaper00003469 | |||||
Curator_confirmed | WBPerson557 | ||||||
Remark | Sometimes centrosomal-pronuclear complex fails to center and rotate. | Paper_evidence | WBPaper00003469 | ||||
Curator_confirmed | WBPerson557 | ||||||
Reference | WBPaper00005320 | ||||||
WBPaper00003469 | |||||||
Method | Substitution_allele |