WormBase Tree Display for Variation: WBVar00249010

WBVar00249010 Evidence: Paper_evidence: WBPaper00005799
  Name: Public_name: sy557
    Other_name (38)
    HGVSg: CHROMOSOME_III:g.4140739C>A
  Sequence_details: SMap: S_parent: Sequence: C30D11
    Flanking_sequences: gtggtgtcggatccaggaaaaattgccacg attacttcaaaggatggttcatcatcgatat
    Mapping_target: C30D11
    Type_of_mutation: Substitution: c a Paper_evidence: WBPaper00005799
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00030937
    Laboratory: PS
    Status: Live
  Affects: Gene: WBGene00006830
    Transcript (19)
    Interactor: WBInteraction000505188
  Genetics: Interpolated_map_position: III -3.7843
  Description: Phenotype: WBPhenotype:0004008 Paper_evidence: WBPaper00005799
        Curator_confirmed: WBPerson625
        Remark: spicule protraction constitutive Paper_evidence: WBPaper00005799
            Curator_confirmed: WBPerson625
        EQ_annotations: Anatomy_term: WBbt:0005312 PATO:0000460 Paper_evidence: WBPaper00005799
                Curator_confirmed: WBPerson625
  Reference: WBPaper00005799
    WBPaper00023932
    WBPaper00019178
    WBPaper00023933
    WBPaper00025521
  Remark: In addition to the curated lesion, sy557 also carries a T->C substitution with flanks of tgcacttatagcacattggttggcatgtatatggcatgtatatggtgagattttaagattgcacttatagcacattggttggcatgtata & ggtgagattttaagatttatcaaaaaaaaa giving rise to a W(244)R mutation
    Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006830 Missense 244 W to R
  Method: Substitution_allele