WormBase Tree Display for Variation: WBVar00248993
expand all nodes | collapse all nodes | view schema
WBVar00248993 | Evidence | Paper_evidence | WBPaper00003592 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | sy438 | ||||||
Other_name | C16C2.2b.1:c.1199C>T | |||||||
CE17404:p.Ser400Phe | ||||||||
CE30491:p.Ser400Phe | ||||||||
C16C2.2a.1:c.1199C>T | ||||||||
C16C2.3a.1:c.-62+3103G>A | ||||||||
HGVSg | CHROMOSOME_I:g.9724831C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | C16C2 | ||||
Flanking_sequences | caaaggattcatatccacgtttcgtccgat | ccaaatctacaaagcagtattgacagcagc | ||||||
Mapping_target | C16C2 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003592 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | PS | |||||||
Status | Live | |||||||
Affects | Gene (2) | |||||||
Transcript | C16C2.2b.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | |||||||
HGVSc | C16C2.2b.1:c.1199C>T | |||||||
HGVSp | CE30491:p.Ser400Phe | |||||||
cDNA_position | 1287 | |||||||
CDS_position | 1199 | |||||||
Protein_position | 400 | |||||||
Exon_number | 9/12 | |||||||
Codon_change | tCc/tTc | |||||||
Amino_acid_change | S/F | |||||||
C16C2.2a.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | |||||||
HGVSc | C16C2.2a.1:c.1199C>T | |||||||
HGVSp | CE17404:p.Ser400Phe | |||||||
cDNA_position | 1282 | |||||||
CDS_position | 1199 | |||||||
Protein_position | 400 | |||||||
Exon_number | 9/12 | |||||||
Codon_change | tCc/tTc | |||||||
Amino_acid_change | S/F | |||||||
C16C2.3a.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | C16C2.3a.1:c.-62+3103G>A | |||||||
Intron_number | 1/14 | |||||||
Genetics | Interpolated_map_position | I | 3.86981 | |||||
Description | Phenotype | WBPhenotype:0001618 | Paper_evidence | WBPaper00004721 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit an EC50 of ~0.73 for halothane, whereas N2 has an EC50 of ~0.42 vol%, as determined by a concentration-response curve based on animal dispersal indexes. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00001705 | Paper_evidence | WBPaper00004721 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001619 | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit an EC50 of ~1.20 for isoflurane, whereas N2 has an EC50 of ~0.75 vol% as determined by a concentration-response curve based on animal dispersal indexes. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00004563 | Paper_evidence | WBPaper00004721 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000641 | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit a similar Dispersal Index (DI) as N2. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Dispersal assay as reported in Crowder et al.1996; van Swinderen et al. 1997. Disperal measured in air. | Paper_evidence | WBPaper00004721 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00004721 | |||||||
Method | Substitution_allele |