WormBase Tree Display for Variation: WBVar00248971

WBVar00248971 Evidence: Paper_evidence: WBPaper00026831
  Name: Public_name: sy327
    Other_name (12)
    HGVSg: CHROMOSOME_IV:g.7688241A>C
  Sequence_details: SMap: S_parent: Sequence: F33D4
    Flanking_sequences: tgcgacggtggaaacatatttgatgggttt agaaatcaatccatggaagagagacaaagt
    Mapping_target: F33D4
    Type_of_mutation: Substitution: a y Paper_evidence: WBPaper00026831
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00030857
    Laboratory: PS
    Status: Live
  Affects: Gene: WBGene00002173
    Transcript: F33D4.2d.1 (12)
      F33D4.2g.1 (12)
      F33D4.2a.1 (12)
      F33D4.2f.1 (12)
      F33D4.2h.1 (12)
      F33D4.2e.1 (12)
    Interactor: WBInteraction000050845
      WBInteraction000050846
      WBInteraction000050847
      WBInteraction000576761
      WBInteraction000576764
  Genetics: Interpolated_map_position: IV 3.37929
  Description: Phenotype: WBPhenotype:0000145 Paper_evidence: WBPaper00003017
        Curator_confirmed: WBPerson625
        Remark: suppresses let-23 sterilty (ovulation) Paper_evidence: WBPaper00003017
            Curator_confirmed: WBPerson625
        Phenotype_assay: Genotype: let-23(sy10) Paper_evidence: WBPaper00003017
              Curator_confirmed: WBPerson625
      WBPhenotype:0000209 Paper_evidence: WBPaper00031535
        Curator_confirmed: WBPerson2987
        Remark: "We obtained animals in which the itr-1(sy327) mutation was linked to unc-24(e138) (0.14 cM apart), and we have been unable to isolate itr-1(sy327) single mutants. Therefore, we compared the effect of VPA between itr-1(sy327) unc-24(e138) double mutants and unc-24(e138) single mutants. Single unc-24(e138) mutants had a slightly elongated defecation cycle, however, the cycle was elongated in response to VPA addition equivalent to that of wild-type animals (Figure 3A). The ability of VPA to increase defecation cycle length was strongly reduced by the itr-1(sy327) gain-of-function mutation [VPA-mediated increases in mean defecation cycle length were 16.3 +/- 4.0 s in wild type, 15.0 +/- 7.8 s in unc-24(e138), and 7.4 +/- 1.6 s in itr-1(sy327) unc-24(e138) double mutants]. VPA-mediated increases in the variability of defecation cycle length were also strongly suppressed by the itr-1(sy327) gain-of-function mutation (Figure 3, B and C)." Paper_evidence: WBPaper00031535
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00004943 Paper_evidence: WBPaper00031535
              Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: unc-24(e138) Paper_evidence: WBPaper00031535
              Curator_confirmed: WBPerson2987
      WBPhenotype:0001926 Paper_evidence: WBPaper00031535
        Curator_confirmed: WBPerson2987
        Remark: "We also tested whether the itr-1(sy327) gain-of-function mutation also suppressed VPA defects in the IP3-regulated basal sheath cell contractions. VPA decreased the sheath cell contraction rate of unc-24(e138) control animals; however, itr-1(sy327) unc-24(e138) double mutants were not affected by VPA (Figure 2C)." Paper_evidence: WBPaper00031535
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00004943 Paper_evidence: WBPaper00031535
              Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: unc-24(e138) Paper_evidence: WBPaper00031535
              Curator_confirmed: WBPerson2987
    Phenotype_not_observed: WBPhenotype:0000207 Paper_evidence: WBPaper00028479
        Curator_confirmed: WBPerson2987
        Remark: Figure 6A Paper_evidence: WBPaper00028479
            Curator_confirmed: WBPerson2987
  Reference: WBPaper00031535
    WBPaper00026831
    WBPaper00028479
    WBPaper00003017
  Remark: Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00002173 Missense 899 L to F Paper_evidence: WBPaper00026831
  Method: Substitution_allele