WormBase Tree Display for Variation: WBVar00248969
expand all nodes | collapse all nodes | view schema
| WBVar00248969 | Evidence | Paper_evidence | WBPaper00024331 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | sy324 | |||||||
| Other_name | C54D1.6.1:c.910C>T | ||||||||
| CE08973:p.Gln304Ter | |||||||||
| HGVSg | CHROMOSOME_X:g.7168690G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C54D1 | |||||
| Flanking_sequences | aaaatcaagtttgtgaaaatgggaggacct | aaaaactgctcatgctactacaacacagag | |||||||
| Mapping_target | C54D1 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00024331 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | PS | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000238 | |||||||
| Transcript | C54D1.6.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | C54D1.6.1:c.910C>T | ||||||||
| HGVSp | CE08973:p.Gln304Ter | ||||||||
| cDNA_position | 919 | ||||||||
| CDS_position | 910 | ||||||||
| Protein_position | 304 | ||||||||
| Exon_number | 9/19 | ||||||||
| Codon_change | Caa/Taa | ||||||||
| Amino_acid_change | Q/* | ||||||||
| Interactor | WBInteraction000001242 | ||||||||
| Isolation | Mutagen | EMS | |||||||
| Genetics | Interpolated_map_position | X | -1.80994 | ||||||
| Description | Phenotype (9) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000594 | Paper_evidence | WBPaper00004662 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "We therefore determined the orientation of P(11/12)L/R migration in mutants affecting P12 determination: a lin-44; lin-3 double mutant, a lin-17 mutant (LIN-17 is the putative receptor of Wnt/LIN-44; Herman et_al, 1995; Sawa et_al, 1996), a bar-1 mutant (BAR-1/Armadillo is an effector of the Wnt pathway; Eisenmann et_al, 1998), and an egl-5 mutant. In all mutants observed, both cells of the P11/12 pair generally adopt the P11 fate (Table 1A). If the migration handedness was a consequence of fate determination, it should be unbiased in these mutants. However, we see a biased migration pattern of P(11/12)L/R similar to that of wild type (Table 1A). Thus, a left-right asymmetry between the two cells of the P11/12 pair still exists in mutants of their final fate determination." | Paper_evidence | WBPaper00004662 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0004409 | PATO:0000460 | Paper_evidence | WBPaper00004662 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000690 | Paper_evidence | WBPaper00004408 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Table 3 | Paper_evidence | WBPaper00004408 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005175 | PATO:0000460 | Paper_evidence | WBPaper00004408 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Reference | WBPaper00024331 | ||||||||
| WBPaper00004408 | |||||||||
| WBPaper00004662 | |||||||||
| Method | Substitution_allele |
