WormBase Tree Display for Variation: WBVar00248969
expand all nodes | collapse all nodes | view schema
WBVar00248969 | Evidence | Paper_evidence | WBPaper00024331 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | sy324 | |||||||
Other_name | C54D1.6.1:c.910C>T | ||||||||
CE08973:p.Gln304Ter | |||||||||
HGVSg | CHROMOSOME_X:g.7168690G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C54D1 | |||||
Flanking_sequences | aaaatcaagtttgtgaaaatgggaggacct | aaaaactgctcatgctactacaacacagag | |||||||
Mapping_target | C54D1 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00024331 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | PS | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000238 | |||||||
Transcript | C54D1.6.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C54D1.6.1:c.910C>T | ||||||||
HGVSp | CE08973:p.Gln304Ter | ||||||||
cDNA_position | 919 | ||||||||
CDS_position | 910 | ||||||||
Protein_position | 304 | ||||||||
Exon_number | 9/19 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000001242 | ||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | X | -1.80994 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00004408 | |||||
Person_evidence | WBPerson156 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson2987 | |||||||||
Remark | Egl/Pvl due to defects in vulval precursor cell induction. | Person_evidence | WBPerson156 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Table 3 | Paper_evidence | WBPaper00004408 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 12% penetrant | Paper_evidence | WBPaper00004408 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Recessive | Person_evidence | WBPerson156 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson156 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000038 | Paper_evidence | WBPaper00004408 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 3 | Paper_evidence | WBPaper00004408 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Low | 5% penetrant | Paper_evidence | WBPaper00004408 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00004408 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000216 | Paper_evidence | WBPaper00024331 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 3 | Paper_evidence | WBPaper00024331 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 66 | Paper_evidence | WBPaper00024331 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations (2) | |||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00024331 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | muIs35 [mec-7::GFP]; ccIs9753 [myo-2::GFP, pes-10::gfp, F22B7.9::gfp] | Paper_evidence | WBPaper00024331 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000414 | Paper_evidence | WBPaper00004408 | |||||||
WBPaper00004662 | |||||||||
Person_evidence | WBPerson156 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson2987 | |||||||||
Remark | P12 to P11 cell fate transformation. | Person_evidence | WBPerson156 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Animals exhibit two large P11.p-like hypodermal nuclei immediately anterior to the anus, indicating a P12 to P11 cell-fate transformation (Table 3) | Paper_evidence | WBPaper00004408 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"We therefore determined the orientation of P(11/12)L/R migration in mutants affecting P12 determination: a lin-44; lin-3 double mutant, a lin-17 mutant (LIN-17 is the putative receptor of Wnt/LIN-44; Herman et_al, 1995; Sawa et_al, 1996), a bar-1 mutant (BAR-1/Armadillo is an effector of the Wnt pathway; Eisenmann et_al, 1998), and an egl-5 mutant. In all mutants observed, both cells of the P11/12 pair generally adopt the P11 fate (Table 1A). If the migration handedness was a consequence of fate determination, it should be unbiased in these mutants. However, we see a biased migration pattern of P(11/12)L/R similar to that of wild type (Table 1A). Thus, a left-right asymmetry between the two cells of the P11/12 pair still exists in mutants of their final fate determination." | Paper_evidence | WBPaper00004662 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 89% penetrant | Paper_evidence | WBPaper00004408 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Complete | 100 | Paper_evidence | WBPaper00004662 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Recessive | Person_evidence | WBPerson156 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson156 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006899 | PATO:0000460 | Paper_evidence | WBPaper00004408 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0006900 | PATO:0000460 | Paper_evidence | WBPaper00004408 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004409 | PATO:0000460 | Paper_evidence | WBPaper00004662 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00024331 | |||||||
Person_evidence | WBPerson156 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson2987 | |||||||||
Remark | Defects in migration of the QL progeny. | Person_evidence | WBPerson156 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Table 3 | Paper_evidence | WBPaper00024331 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Complete | 100 | Paper_evidence | WBPaper00024331 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Recessive | Person_evidence | WBPerson156 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson156 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations (2) | |||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00024331 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | muIs35 [mec-7::GFP]; ccIs9753 [myo-2::GFP, pes-10::gfp, F22B7.9::gfp] | Paper_evidence | WBPaper00024331 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000695 | Paper_evidence | WBPaper00004408 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 3 | Paper_evidence | WBPaper00004408 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 37% penetrant | Paper_evidence | WBPaper00004408 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00004408 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000697 | Paper_evidence | WBPaper00004408 | |||||||
Person_evidence | WBPerson156 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson2987 | |||||||||
Remark | Egl/Pvl due to defects in vulval precursor cell induction. | Person_evidence | WBPerson156 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Table 3 | Paper_evidence | WBPaper00004408 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 16% penetrant | Paper_evidence | WBPaper00004408 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Recessive | Person_evidence | WBPerson156 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson156 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00004408 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000886 | Paper_evidence | WBPaper00024331 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Authors scored for animals on plate that showed Egl (egg laying defective), Pvl (protruding vulva), Bag (bag of worms), or Spew (burst through vulva) phenotypes (Table 3) | Paper_evidence | WBPaper00024331 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Complete | 100 | Paper_evidence | WBPaper00024331 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00024331 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | muIs35 [mec-7::GFP]; ccIs9753 [myo-2::GFP, pes-10::gfp, F22B7.9::gfp] | Paper_evidence | WBPaper00024331 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001272 | Paper_evidence | WBPaper00024331 | |||||||
Person_evidence | WBPerson156 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson2987 | |||||||||
Remark | Table 3 | Paper_evidence | WBPaper00024331 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 21 | Paper_evidence | WBPaper00024331 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Recessive | Person_evidence | WBPerson156 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson156 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations (2) | |||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00024331 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | muIs35 [mec-7::GFP]; ccIs9753 [myo-2::GFP, pes-10::gfp, F22B7.9::gfp] | Paper_evidence | WBPaper00024331 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000594 | Paper_evidence | WBPaper00004662 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We therefore determined the orientation of P(11/12)L/R migration in mutants affecting P12 determination: a lin-44; lin-3 double mutant, a lin-17 mutant (LIN-17 is the putative receptor of Wnt/LIN-44; Herman et_al, 1995; Sawa et_al, 1996), a bar-1 mutant (BAR-1/Armadillo is an effector of the Wnt pathway; Eisenmann et_al, 1998), and an egl-5 mutant. In all mutants observed, both cells of the P11/12 pair generally adopt the P11 fate (Table 1A). If the migration handedness was a consequence of fate determination, it should be unbiased in these mutants. However, we see a biased migration pattern of P(11/12)L/R similar to that of wild type (Table 1A). Thus, a left-right asymmetry between the two cells of the P11/12 pair still exists in mutants of their final fate determination." | Paper_evidence | WBPaper00004662 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004409 | PATO:0000460 | Paper_evidence | WBPaper00004662 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000690 | Paper_evidence | WBPaper00004408 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 3 | Paper_evidence | WBPaper00004408 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005175 | PATO:0000460 | Paper_evidence | WBPaper00004408 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00024331 | ||||||||
WBPaper00004408 | |||||||||
WBPaper00004662 | |||||||||
Method | Substitution_allele |