WormBase Tree Display for Variation: WBVar00248965
expand all nodes | collapse all nodes | view schema
| WBVar00248965 | Evidence | Paper_evidence | WBPaper00025221 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | sy294 | |||||||
| Other_name | CE05215:p.Gly61Val | ||||||||
| C04G2.7.1:c.182G>T | |||||||||
| HGVSg | CHROMOSOME_IV:g.10109221C>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C04G2 | |||||
| Flanking_sequences | cgtgctcaaatagtcgaaatgtcacaacatg | tacacgaccatgtgacatatcaagacagtta | |||||||
| Mapping_target | C04G2 | ||||||||
| Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00025221 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00000924 | ||||||||
| Laboratory | PS | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001204 | |||||||
| Transcript | C04G2.7.1 (12) | ||||||||
| Interactor | WBInteraction000501611 | ||||||||
| WBInteraction000501612 | |||||||||
| WBInteraction000501613 | |||||||||
| WBInteraction000501614 | |||||||||
| WBInteraction000501615 | |||||||||
| WBInteraction000501704 | |||||||||
| WBInteraction000502126 | |||||||||
| WBInteraction000503515 | |||||||||
| WBInteraction000541703 | |||||||||
| WBInteraction000555941 | |||||||||
| Genetics | Interpolated_map_position | IV | 4.52959 | ||||||
| Mapping_data | In_multi_point | 3130 | |||||||
| 3131 | |||||||||
| Description | Phenotype (18) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000197 | Paper_evidence | WBPaper00002924 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | U cell fate is induced normally in L1 males;hoever, subsequent behavior follows the Y cell program. | Paper_evidence | WBPaper00002924 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Recessive | Paper_evidence | WBPaper00002924 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00002924 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0004942 | PATO:0000460 | Paper_evidence | WBPaper00002924 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000831 | Paper_evidence | WBPaper00002924 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | During L2 and L3 male stages the presumptive Y cell developed normally | Paper_evidence | WBPaper00002924 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Recessive | Paper_evidence | WBPaper00002924 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00002924 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0004578 | PATO:0000460 | Paper_evidence | WBPaper00002924 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference (11) | |||||||||
| Method | Substitution_allele |
