WormBase Tree Display for Variation: WBVar00248962
expand all nodes | collapse all nodes | view schema
| WBVar00248962 | Evidence | Paper_evidence | WBPaper00026831 | |||||
|---|---|---|---|---|---|---|---|---|
| Name | Public_name | sy290 | ||||||
| Other_name (12) | ||||||||
| HGVSg | CHROMOSOME_IV:g.7686702C>T | |||||||
| Sequence_details | SMap | S_parent | Sequence | F33D4 | ||||
| Flanking_sequences | attctaatgaatacaaatttgtttcaggtc | gcgatctggattttgcaaatgatgcatgca | ||||||
| Mapping_target | F33D4 | |||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00026831 | |||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Strain | WBStrain00030832 | |||||||
| WBStrain00030844 | ||||||||
| WBStrain00030866 | ||||||||
| WBStrain00040665 | ||||||||
| Laboratory | PS | |||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00002173 | ||||||
| Transcript | F33D4.2d.1 (12) | |||||||
| F33D4.2g.1 (12) | ||||||||
| F33D4.2a.1 (12) | ||||||||
| F33D4.2f.1 (12) | ||||||||
| F33D4.2h.1 (12) | ||||||||
| F33D4.2e.1 (12) | ||||||||
| Interactor (8) | ||||||||
| Genetics | Interpolated_map_position | IV | 3.37733 | |||||
| Description | Phenotype | WBPhenotype:0000145 | Paper_evidence | WBPaper00003017 | ||||
| Curator_confirmed | WBPerson625 | |||||||
| Remark | suppresses let-23 sterilty (ovulation) | Paper_evidence | WBPaper00003017 | |||||
| Curator_confirmed | WBPerson625 | |||||||
| Phenotype_assay | Genotype | let-23(sy10) | Paper_evidence | WBPaper00003017 | ||||
| Curator_confirmed | WBPerson625 | |||||||
| WBPhenotype:0000154 | Paper_evidence | WBPaper00042394 | ||||||
| WBPaper00040692 | ||||||||
| Curator_confirmed | WBPerson1777 | |||||||
| WBPerson2987 | ||||||||
| Remark | Decreased brood size compared to wildtype | Paper_evidence | WBPaper00042394 | |||||
| Curator_confirmed | WBPerson1777 | |||||||
| "... the weak itr-1 loss-of-function (LOF) allele sa73 reduces brood size by ~75%, while the itr-1 gain-of-function (GOF) allele sy290 reduces brood size by only ~25% (Figure 7A) [15,16]." | Paper_evidence | WBPaper00040692 | ||||||
| Curator_confirmed | WBPerson2987 | |||||||
| Variation_effect | Gain_of_function_undetermined_type | Paper_evidence | WBPaper00040692 | |||||
| Curator_confirmed | WBPerson2987 | |||||||
| Phenotype_not_observed | WBPhenotype:0000207 | Paper_evidence | WBPaper00028479 | |||||
| Curator_confirmed | WBPerson2987 | |||||||
| Remark | Figure 6A | Paper_evidence | WBPaper00028479 | |||||
| Curator_confirmed | WBPerson2987 | |||||||
| WBPhenotype:0000666 | Paper_evidence | WBPaper00042394 | ||||||
| Curator_confirmed | WBPerson1777 | |||||||
| Remark | Do not exhibit overt ovulation or spermathecal transit defects; however, the sheath cell contractions are more frequent in these animals | Paper_evidence | WBPaper00042394 | |||||
| Curator_confirmed | WBPerson1777 | |||||||
| There were no detected changes in calcium dynamics, such as increased propagation speed nor increased frequency | Paper_evidence | WBPaper00042394 | ||||||
| Curator_confirmed | WBPerson1777 | |||||||
| Reference | WBPaper00040692 | |||||||
| WBPaper00040893 | ||||||||
| WBPaper00028479 | ||||||||
| WBPaper00003017 | ||||||||
| WBPaper00016949 | ||||||||
| WBPaper00023320 | ||||||||
| WBPaper00030553 | ||||||||
| WBPaper00042394 | ||||||||
| Method | Substitution_allele |
