WormBase Tree Display for Variation: WBVar00248942

WBVar00248942 Evidence: Paper_evidence: WBPaper00003566
  Name: Public_name: sy217
    Other_name: C09H6.2b.1:c.139C>T
      C09H6.2a.1:c.139C>T
      CE27060:p.Gln47Ter
      CE15610:p.Gln47Ter
    HGVSg: CHROMOSOME_I:g.8119175G>A
  Sequence_details: SMap: S_parent: Sequence: C09H6
    Flanking_sequences: gccggtggtggtgggggaggagagcaacaa aagtcccatttcgttagttttacaagagatt
    Mapping_target: C09H6
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00003566
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: PS
    Status: Live
  Affects: Gene: WBGene00002999
    Transcript: C09H6.2b.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: C09H6.2b.1:c.139C>T
        HGVSp: CE27060:p.Gln47Ter
        cDNA_position: 142
        CDS_position: 139
        Protein_position: 47
        Exon_number: 2/17
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      C09H6.2a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: C09H6.2a.1:c.139C>T
        HGVSp: CE15610:p.Gln47Ter
        cDNA_position: 140
        CDS_position: 139
        Protein_position: 47
        Exon_number: 2/18
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
    Interactor: WBInteraction000555590
      WBInteraction000555591
  Genetics: Interpolated_map_position: I 2.55966
  Description: Phenotype: WBPhenotype:0000436 Paper_evidence: WBPaper00003566
        Curator_confirmed: WBPerson2021
        Remark: In the vulval precursor cells of lin-10 mutants, strong LET-23 staining was observed in the apical membrane domains and no LET-23 staining was observed in the basolateral membrane domains (unlike wild-type) Paper_evidence: WBPaper00003566
            Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: Staining with anti-LET-23 antibodies Paper_evidence: WBPaper00003566
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001410 Paper_evidence: WBPaper00003566
        Curator_confirmed: WBPerson2021
        Remark: Both 140- and 70-kDa bands are absent in protein extracts from lin-10(n299) and lin-10(sy217) mutants. Paper_evidence: WBPaper00003566
            Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: Western blotting experiments using anti-LIN-10 antibodies Paper_evidence: WBPaper00003566
              Curator_confirmed: WBPerson2021
    Phenotype_not_observed: WBPhenotype:0000104 Paper_evidence: WBPaper00003566
        Curator_confirmed: WBPerson2021
        Remark: No general loss of cell polarity as assayed by the morphology of both the basal lamina and the cuticle surrounding the vulval precursor cells Paper_evidence: WBPaper00003566
            Curator_confirmed: WBPerson2021
      WBPhenotype:0001658 Paper_evidence: WBPaper00003566
        Curator_confirmed: WBPerson2021
        Remark: The cell junctions appear normal in lin-10 mutants, as indicated by staining with the cell junction mAb MH27 Paper_evidence: WBPaper00003566
            Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: Staining with the cell junction mAb MH27 Paper_evidence: WBPaper00003566
              Curator_confirmed: WBPerson2021
  Reference: WBPaper00003566
  Method: Substitution_allele