WormBase Tree Display for Variation: WBVar00248920
expand all nodes | collapse all nodes | view schema
| WBVar00248920 | Evidence | Paper_evidence | WBPaper00002227 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | sy143 | |||||
| Other_name | M02A10.3c.1:c.403C>T | ||||||
| CE25058:p.Gln152Ter | |||||||
| M02A10.3a.1:c.454C>T | |||||||
| M02A10.3b.1:c.403C>T | |||||||
| CE27393:p.Gln135Ter | |||||||
| CE37131:p.Gln135Ter | |||||||
| HGVSg | CHROMOSOME_X:g.724458G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | M02A10 | |||
| Flanking_sequences | ctgttcaagacgtcagctatctacaatgac | agtctgaagaacgacggaagcttacgaaaa | |||||
| Mapping_target | M02A10 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002227 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00030821 | ||||||
| WBStrain00030825 | |||||||
| WBStrain00030836 | |||||||
| WBStrain00030870 | |||||||
| Laboratory | PS | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00004829 | |||||
| Transcript | M02A10.3b.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | M02A10.3b.1:c.403C>T | ||||||
| HGVSp | CE27393:p.Gln135Ter | ||||||
| cDNA_position | 478 | ||||||
| CDS_position | 403 | ||||||
| Protein_position | 135 | ||||||
| Exon_number | 5/12 | ||||||
| Codon_change | Cag/Tag | ||||||
| Amino_acid_change | Q/* | ||||||
| M02A10.3c.1 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | M02A10.3c.1:c.403C>T | ||||||
| HGVSp | CE37131:p.Gln135Ter | ||||||
| cDNA_position | 467 | ||||||
| CDS_position | 403 | ||||||
| Protein_position | 135 | ||||||
| Exon_number | 5/11 | ||||||
| Codon_change | Cag/Tag | ||||||
| Amino_acid_change | Q/* | ||||||
| M02A10.3a.1 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | M02A10.3a.1:c.454C>T | ||||||
| HGVSp | CE25058:p.Gln152Ter | ||||||
| cDNA_position | 518 | ||||||
| CDS_position | 454 | ||||||
| Protein_position | 152 | ||||||
| Exon_number | 6/13 | ||||||
| Codon_change | Cag/Tag | ||||||
| Amino_acid_change | Q/* | ||||||
| Interactor | WBInteraction000500502 | ||||||
| WBInteraction000519096 | |||||||
| WBInteraction000519104 | |||||||
| WBInteraction000519105 | |||||||
| WBInteraction000521742 | |||||||
| WBInteraction000524527 | |||||||
| Genetics | Interpolated_map_position | X | -19.5051 | ||||
| Mapping_data | In_multi_point | 2319 | |||||
| 2320 | |||||||
| In_pos_neg_data | 5879 | ||||||
| 6860 | |||||||
| 6861 | |||||||
| 6862 | |||||||
| Description | Phenotype | WBPhenotype:0000071 | Person_evidence | WBPerson261 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | low penetrance head morphology defect in let-23(+) background, sy143/Df similar | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Phenotype_not_observed | WBPhenotype:0000218 | Paper_evidence | WBPaper00031110 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | No significant number of overinduced animals (worms with greater than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000219 | Paper_evidence | WBPaper00031110 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | No underinduced animals (worms with fewer than 22 vulval cells or fewer than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00014707 | ||||||
| WBPaper00021834 | |||||||
| WBPaper00017293 | |||||||
| WBPaper00022377 | |||||||
| WBPaper00031110 | |||||||
| WBPaper00015247 | |||||||
| WBPaper00021791 | |||||||
| WBPaper00022151 | |||||||
| Method | Substitution_allele |
