WormBase Tree Display for Variation: WBVar00248919
expand all nodes | collapse all nodes | view schema
WBVar00248919 | Evidence | Paper_evidence | WBPaper00001366 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | sy130 | |||||
Other_name | ZK792.6.1:c.38G>A | ||||||
CE03827:p.Gly13Glu | |||||||
HGVSg | CHROMOSOME_IV:g.11691040C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | ZK792 | |||
Flanking_sequences | agtacaagcttgtggtagttggagatggag | agttggtaaatcagcactcaccattcaact | |||||
Mapping_target | ZK792 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001366 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | PS | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00002335 | |||||
Transcript | ZK792.6.1 (12) | ||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00001366 | |||
Genetics | Interpolated_map_position | IV | 5.21063 | ||||
Description | Phenotype | WBPhenotype:0000700 | Person_evidence | WBPerson261 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | identical to n1046 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Semi_dominant | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Hypermorph_gain_of_function | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_not_observed | WBPhenotype:0001024 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | identical to n1046 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Semi_dominant | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Hypermorph_gain_of_function | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00001366 | ||||||
Method | Substitution_allele |