WormBase Tree Display for Variation: WBVar00248908
expand all nodes | collapse all nodes | view schema
WBVar00248908 | Evidence | Paper_evidence | WBPaper00001756 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | Y73B6A | |||||
Flanking_sequences | acaattcttatctaaaacatttaattttca | ctagtgaaagaactctttgggatcgcatca | |||||||
Mapping_target | Y73B6A | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001756 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00027280 | ||||||||
WBStrain00030711 | |||||||||
WBStrain00030713 | |||||||||
WBStrain00030718 | |||||||||
WBStrain00030812 | |||||||||
Laboratory | PS | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003030 | |||||||
Transcript | Y73B6A.5c.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y73B6A.5c.1:c.640-1G>A | ||||||||
Intron_number | 5/13 | ||||||||
Y73B6A.5e.1 | VEP_consequence | splice_acceptor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y73B6A.5e.1:c.589-1G>A | ||||||||
Intron_number | 5/13 | ||||||||
Y73B6A.5f.1 | VEP_consequence | splice_acceptor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y73B6A.5f.1:c.553-1G>A | ||||||||
Intron_number | 3/10 | ||||||||
Y73B6A.5b.1 | VEP_consequence | splice_acceptor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y73B6A.5b.1:c.811-1G>A | ||||||||
Intron_number | 5/13 | ||||||||
Y73B6A.5a.1 | VEP_consequence | splice_acceptor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y73B6A.5a.1:c.685-1G>A | ||||||||
Intron_number | 4/12 | ||||||||
Y73B6A.5d.1 | VEP_consequence | splice_acceptor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y73B6A.5d.1:c.760-1G>A | ||||||||
Intron_number | 6/14 | ||||||||
Interactor | WBInteraction000519051 | ||||||||
WBInteraction000535559 | |||||||||
WBInteraction000563586 | |||||||||
WBInteraction000563587 | |||||||||
WBInteraction000563588 | |||||||||
Genetics | Interpolated_map_position | IV | 3.22834 | ||||||
Mapping_data | In_multi_point | 1641 | |||||||
1642 | |||||||||
1929 | |||||||||
3152 | |||||||||
Description | Phenotype (11) | ||||||||
Phenotype_not_observed | WBPhenotype:0001084 | Paper_evidence | WBPaper00003955 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00003955 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005670 | PATO:0000460 | Paper_evidence | WBPaper00003955 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002193 | Paper_evidence | WBPaper00044058 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "No allele of egl-17, egl-15 or any other downstream FGF component other than sem-5 had any effect on orientation as single mutants (Table 1), which is probably due to the involvement of sem-5 in one of the other pathways controlling vulval orientation as well as its role in the FGF pathway." | Paper_evidence | WBPaper00044058 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006895 | PATO:0000460 | Paper_evidence | WBPaper00044058 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002378 | Paper_evidence | WBPaper00054670 | |||||||
Curator_confirmed | WBPerson2706 | ||||||||
Remark | animals avoid OP50 lawns contaminated with Microbacterium nematophilum as wild type | Paper_evidence | WBPaper00054670 | ||||||
Curator_confirmed | WBPerson2706 | ||||||||
Reference (20) | |||||||||
Method | Substitution_allele |