WormBase Tree Display for Variation: WBVar00248906
expand all nodes | collapse all nodes | view schema
WBVar00248906 | Evidence | Paper_evidence | WBPaper00001485 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | sy94 | |||||||
Other_name | CE03827:p.Lys16Asn | ||||||||
ZK792.6.1:c.48A>T | |||||||||
HGVSg | CHROMOSOME_IV:g.11691030T>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK792 | |||||
Flanking_sequences | attctggatgagttgaatggtgagtgctga | ttaccaactcctccatctccaactaccaca | |||||||
Mapping_target | ZK792 | ||||||||
Type_of_mutation | Substitution | t | a | Curator_confirmed | WBPerson4055 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | PS | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002335 | |||||||
Transcript | ZK792.6.1 (12) | ||||||||
Genetics | Interpolated_map_position | IV | 5.21063 | ||||||
Description | Phenotype | WBPhenotype:0000062 | Paper_evidence | WBPaper00001485 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Remark | recessive lethal | Paper_evidence | WBPaper00001485 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
Recessive | Paper_evidence | WBPaper00001485 | |||||||
Curator_confirmed | WBPerson625 | ||||||||
WBPhenotype:0000698 | Paper_evidence | WBPaper00001485 | |||||||
Curator_confirmed | WBPerson625 | ||||||||
Remark | vulvaless (dominant) | Paper_evidence | WBPaper00001485 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
Dominant | Paper_evidence | WBPaper00001485 | |||||||
Curator_confirmed | WBPerson625 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00001485 | ||||
Curator_confirmed | WBPerson625 | ||||||||
Reference | WBPaper00001485 | ||||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||||
Method | Substitution_allele |