WormBase Tree Display for Variation: WBVar00248891
expand all nodes | collapse all nodes | view schema
WBVar00248891 | Evidence | Paper_evidence | WBPaper00001404 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | sy17 | |||||||
Other_name | ZK1067.1c.1:c.511+1G>A | ||||||||
ZK1067.1a.1:c.496+1G>A | |||||||||
ZK1067.1d.1:c.532+1G>A | |||||||||
ZK1067.1b.1:c.313+1G>A | |||||||||
HGVSg | CHROMOSOME_II:g.9199587G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK1067 | |||||
Flanking_sequences | ttcacgaagttgtgatgagagagttgagag | tttgtttgctcagcttttagagacatagta | |||||||
Mapping_target | ZK1067 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00002299 | |||||||
Transcript | ZK1067.1d.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1067.1d.1:c.532+1G>A | ||||||||
Intron_number | 6/20 | ||||||||
ZK1067.1b.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1067.1b.1:c.313+1G>A | ||||||||
Intron_number | 2/15 | ||||||||
ZK1067.1c.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1067.1c.1:c.511+1G>A | ||||||||
Intron_number | 4/18 | ||||||||
ZK1067.1a.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1067.1a.1:c.496+1G>A | ||||||||
Intron_number | 5/19 | ||||||||
Genetics | Interpolated_map_position | II | 1.09428 | ||||||
Description | Phenotype | WBPhenotype:0000062 | Paper_evidence | WBPaper00001404 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Identified in a noncomplementation screen with let-23(sy1) scoring for the Vulvaless phenotype. | Paper_evidence | WBPaper00001404 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001404 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001278 | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | neurons did not show a loss in unc-25::GFP expression | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014913 | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005027 | PATO:0000460 | Paper_evidence | WBPaper00057074 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005021 | PATO:0000460 | Paper_evidence | WBPaper00057074 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00001404 | ||||||||
WBPaper00057074 | |||||||||
Method | Substitution_allele |