WormBase Tree Display for Variation: WBVar00248888
expand all nodes | collapse all nodes | view schema
WBVar00248888 | Evidence | Paper_evidence | WBPaper00001404 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | sy14 | ||||||
Other_name | ZK1067.1c.1:c.1907+1G>A | |||||||
ZK1067.1a.1:c.1892+1G>A | ||||||||
ZK1067.1b.1:c.1709+1G>A | ||||||||
ZK1067.1d.1:c.1928+1G>A | ||||||||
HGVSg | CHROMOSOME_II:g.9201861G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK1067 | ||||
Flanking_sequences | aaagtgtcatccgacgtgttatgataatgg | taagcttcgggttttttttcgattttttaa | ||||||
Mapping_target | ZK1067 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001404 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | PS | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00002299 | ||||||
Transcript | ZK1067.1d.1 | VEP_consequence | splice_donor_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1067.1d.1:c.1928+1G>A | |||||||
Intron_number | 13/20 | |||||||
ZK1067.1b.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1067.1b.1:c.1709+1G>A | |||||||
Intron_number | 9/15 | |||||||
ZK1067.1c.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1067.1c.1:c.1907+1G>A | |||||||
Intron_number | 11/18 | |||||||
ZK1067.1a.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1067.1a.1:c.1892+1G>A | |||||||
Intron_number | 12/19 | |||||||
Genetics | Interpolated_map_position | II | 1.09449 | |||||
Description | Phenotype | WBPhenotype:0000062 | Paper_evidence | WBPaper00001404 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Identified in a noncomplementation screen with let-23(sy1) scoring for the Vulvaless phenotype. | Paper_evidence | WBPaper00001404 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00001404 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00001404 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00001404 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00001404 | |||||||
Method | Substitution_allele |