WormBase Tree Display for Variation: WBVar00248885
expand all nodes | collapse all nodes | view schema
WBVar00248885 | Evidence | Paper_evidence | WBPaper00001404 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | sy5 | |||||
Other_name | ZK1067.1c.1:c.3249G>A | ||||||
ZK1067.1b.1:c.3051G>A | |||||||
CE42910:p.Trp1083Ter | |||||||
ZK1067.1d.1:c.3270G>A | |||||||
ZK1067.1a.1:c.3234G>A | |||||||
CE50411:p.Trp1090Ter | |||||||
CE03840:p.Trp1078Ter | |||||||
CE42891:p.Trp1017Ter | |||||||
HGVSg | CHROMOSOME_II:g.9205776G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | ZK1067 | |||
Flanking_sequences | ctgatgtttgggcatttggagtcacatgttg | gagattataacatttggacaaagtccgtat | |||||
Mapping_target | ZK1067 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001917 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | PS | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00002299 | |||||
Transcript | ZK1067.1d.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | ZK1067.1d.1:c.3270G>A | ||||||
HGVSp | CE50411:p.Trp1090Ter | ||||||
cDNA_position | 3276 | ||||||
CDS_position | 3270 | ||||||
Protein_position | 1090 | ||||||
Exon_number | 17/21 | ||||||
Codon_change | tgG/tgA | ||||||
Amino_acid_change | W/* | ||||||
ZK1067.1b.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK1067.1b.1:c.3051G>A | ||||||
HGVSp | CE42891:p.Trp1017Ter | ||||||
cDNA_position | 3051 | ||||||
CDS_position | 3051 | ||||||
Protein_position | 1017 | ||||||
Exon_number | 13/16 | ||||||
Codon_change | tgG/tgA | ||||||
Amino_acid_change | W/* | ||||||
ZK1067.1c.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK1067.1c.1:c.3249G>A | ||||||
HGVSp | CE42910:p.Trp1083Ter | ||||||
cDNA_position | 3249 | ||||||
CDS_position | 3249 | ||||||
Protein_position | 1083 | ||||||
Exon_number | 15/19 | ||||||
Codon_change | tgG/tgA | ||||||
Amino_acid_change | W/* | ||||||
ZK1067.1a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK1067.1a.1:c.3234G>A | ||||||
HGVSp | CE03840:p.Trp1078Ter | ||||||
cDNA_position | 3323 | ||||||
CDS_position | 3234 | ||||||
Protein_position | 1078 | ||||||
Exon_number | 16/20 | ||||||
Codon_change | tgG/tgA | ||||||
Amino_acid_change | W/* | ||||||
Isolation | Mutagen | EMS | Person_evidence | WBPerson566 | |||
Genetics | Interpolated_map_position | II | 1.09463 | ||||
Description | Phenotype | WBPhenotype:0000062 | Paper_evidence | WBPaper00001404 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Identified in a noncomplementation screen with let-23(sy1) scoring for the Vulvaless phenotype. | Paper_evidence | WBPaper00001404 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive (2) | |||||||
WBPhenotype:0000411 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | similar to sy15 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00001404 | ||||||
WBPaper00001917 | |||||||
Remark | |||||||
Method | Substitution_allele |