WormBase Tree Display for Variation: WBVar00248869
expand all nodes | collapse all nodes | view schema
WBVar00248869 | Evidence | Paper_evidence | WBPaper00005927 | ||||||
---|---|---|---|---|---|---|---|---|---|
WBPaper00001835 | |||||||||
WBPaper00050256 | |||||||||
Name | Public_name | su1006 | |||||||
Other_name | su006 | Paper_evidence | WBPaper00005098 | ||||||
WBPaper00005612 | |||||||||
CE03591:p.Arg71Cys | |||||||||
T01B7.7.1:c.211C>T | |||||||||
HGVSg | CHROMOSOME_II:g.8733311C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | T01B7 | |||||
Flanking_sequences | ggagcaggaaccgcttccaaccgtgtgaga | gtcaacaatatggaggatatggagccactg | |||||||
Mapping_target | T01B7 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00001835 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (270) | |||||||||
Laboratory (13) | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004397 | |||||||
Transcript | T01B7.7.1 (12) | ||||||||
Interactor | WBInteraction000052037 | ||||||||
WBInteraction000052038 | |||||||||
WBInteraction000519642 | |||||||||
WBInteraction000537298 | |||||||||
Genetics | Interpolated_map_position | II | 0.87118 | ||||||
Description | Phenotype | WBPhenotype:0000502 | Paper_evidence | WBPaper00005927 | |||||
WBPaper00000465 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Severe dominant roller L3 through adult and Dauer; heterozygotes are indistinguishable from homozygotes. | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Dominant (2) | |||||||||
EQ_annotations | Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00005927 | ||||
WBPaper00000465 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00005927 | ||||||
WBPaper00000465 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00005927 | ||||||
WBPaper00000465 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
WBls:0000032 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 16C, 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00051549 | |||||||
Curator_confirmed | WBPerson15345 | ||||||||
Phenotype_assay | Genotype | zIs356 [Pdaf-16::daf-16a/b-gfp; rol-6] | Paper_evidence | WBPaper00051549 | |||||
Curator_confirmed | WBPerson15345 | ||||||||
dvIs70 [hsp-16.2::gfp; rol-6(su1006)] | Paper_evidence | WBPaper00051549 | |||||||
Curator_confirmed | WBPerson15345 | ||||||||
WBPhenotype:0000645 | Paper_evidence | WBPaper00000914 | |||||||
WBPaper00005747 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson2987 | |||||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00000914 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Loops are present in the alae. | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001516 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Alae make 2 whole turns along the length of the animal. | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Annulae are slightly deranged. | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000583 | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 16C, 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001515 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (74) | |||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
Method | Substitution_allele |