WormBase Tree Display for Variation: WBVar00248791
expand all nodes | collapse all nodes | view schema
| WBVar00248791 | Name | Public_name | st601 | ||||
|---|---|---|---|---|---|---|---|
| Other_name | CE01925:p.Trp335Ter | ||||||
| F30H5.1.1:c.1005G>A | |||||||
| HGVSg | CHROMOSOME_III:g.494807G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | F30H5 | |||
| Flanking_sequences | GGACGGTGGAATTCCACGTGGATGGTCGTG | AAGTTTGTGGAAGAACGTGGATTGCTCGCG | |||||
| Mapping_target | F30H5 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003295 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00006149 | ||||||
| WBStrain00026329 | |||||||
| Laboratory | RW | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006781 | |||||
| Transcript | F30H5.1.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | F30H5.1.1:c.1005G>A | ||||||
| HGVSp | CE01925:p.Trp335Ter | ||||||
| cDNA_position | 1007 | ||||||
| CDS_position | 1005 | ||||||
| Protein_position | 335 | ||||||
| Exon_number | 7/13 | ||||||
| Codon_change | tgG/tgA | ||||||
| Amino_acid_change | W/* | ||||||
| Isolation | Mutagen | hydroxylamine | |||||
| Genetics | Interpolated_map_position | III | -26.827 | ||||
| Mapping_data | In_multi_point | 3016 | |||||
| 3017 | |||||||
| Description | Phenotype | WBPhenotype:0000112 | Paper_evidence | WBPaper00040187 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | There is no truncated protein fragment at the expected molecular weight produced in +/st601 heterozygous worms detected by western blotting with the polyclonal antibody, which reacts with UCS, TPR(-) and UCS(-) recombinant fragments and full-length UNC-45. | Paper_evidence | WBPaper00040187 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000643 | Person_evidence | WBPerson2251 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| WBPhenotype:0000867 | Paper_evidence | WBPaper00040187 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | The st601 mutation results in severely arrested embryonic development. The injection of full length UNC-45, TPR(-)UNC-45 and UCS(only)UNC-45 constructs rescued the st601 dead egg phenotype, but injection of the UCS(-) construct did not. | Paper_evidence | WBPaper00040187 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00040187 | ||||||
| WBPaper00014049 | |||||||
| WBPaper00016550 | |||||||
| WBPaper00021011 | |||||||
| Remark | The mutation is reported to be W335 to Stop (Opal), with the molecular details entered above. | Person_evidence | WBPerson2251 | ||||
| Method | Substitution_allele |
