WormBase Tree Display for Variation: WBVar00242730
expand all nodes | collapse all nodes | view schema
WBVar00242730 | Evidence | Paper_evidence | WBPaper00032114 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | sm151 | ||||||
Other_name (2) | ||||||||
HGVSg | CHROMOSOME_I:g.9472212G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F30A10 | ||||
Flanking_sequences | cttgatgttacctgcaagactgttgctaacat | atcaagggaaaatctccagaagagattcgtc | ||||||
Mapping_target | F30A10 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00032114 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00005195 | |||||||
Laboratory | CU | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00004807 | ||||||
Transcript | F46A9.5.1 (12) | |||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | I | 3.76797 | |||||
Description | Phenotype_not_observed | WBPhenotype:0000700 | Paper_evidence | WBPaper00032114 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Not Muv | Paper_evidence | WBPaper00032114 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00032114 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000822 | Paper_evidence | WBPaper00032114 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | sm151 hermaphrodites and males alone do not exhibit any defects in sex-determination | Paper_evidence | WBPaper00032114 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00032114 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001218 | Paper_evidence | WBPaper00032114 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | sm151 hermaphrodites and males alone do not exhibit any defects in sex-specific apoptosis | Paper_evidence | WBPaper00032114 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00032114 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | smIs26 [pkd-2p::gfp] | Paper_evidence | WBPaper00032114 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00032114 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No defects in AVL GABAergic neuron axon outgrowth | Paper_evidence | WBPaper00032114 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00032114 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | oxIs12[unc-47::GFP] | Paper_evidence | WBPaper00032114 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001586 | Paper_evidence | WBPaper00032114 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | no 2AC | Paper_evidence | WBPaper00032114 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00032114 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00032114 | |||||||
Method | Substitution_allele |