WormBase Tree Display for Variation: WBVar00242716
expand all nodes | collapse all nodes | view schema
WBVar00242716 | Evidence | Paper_evidence | WBPaper00001835 | ||||
---|---|---|---|---|---|---|---|
Name (3) | |||||||
Sequence_details | SMap | S_parent | Sequence | B0491 | |||
Flanking_sequences | ctctgatggtggagacttgtctgggcactgg | agtactcggcatcctttcctggtcttccgtc | |||||
Mapping_target | B0491 | ||||||
Type_of_mutation | Substitution | c | g | Curator_confirmed | WBPerson4055 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | BE | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00005016 | |||||
Transcript | B0491.2.2 (12) | ||||||
B0491.2.1 (12) | |||||||
Genetics | Interpolated_map_position | II | 3.43913 | ||||
Reference | WBPaper00001835 | ||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
Method | Substitution_allele |