WormBase Tree Display for Variation: WBVar00242716
expand all nodes | collapse all nodes | view schema
WBVar00242716 | Evidence | Paper_evidence | WBPaper00001835 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | sc113 | |||||
Other_name | B0491.2.2:c.908G>C | ||||||
CE02104:p.Cys303Ser | |||||||
B0491.2.1:c.908G>C | |||||||
HGVSg | CHROMOSOME_II:g.11336795C>G | ||||||
Sequence_details | SMap | S_parent | Sequence | B0491 | |||
Flanking_sequences | ctctgatggtggagacttgtctgggcactgg | agtactcggcatcctttcctggtcttccgtc | |||||
Mapping_target | B0491 | ||||||
Type_of_mutation | Substitution | c | g | Curator_confirmed | WBPerson4055 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | BE | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00005016 | |||||
Transcript | B0491.2.2 (12) | ||||||
B0491.2.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | ||||||
SIFT | 0 | deleterious | |||||
PolyPhen | 1 | probably_damaging | |||||
HGVSc | B0491.2.1:c.908G>C | ||||||
HGVSp | CE02104:p.Cys303Ser | ||||||
cDNA_position | 940 | ||||||
CDS_position | 908 | ||||||
Protein_position | 303 | ||||||
Exon_number | 4/5 | ||||||
Codon_change | tGc/tCc | ||||||
Amino_acid_change | C/S | ||||||
Genetics | Interpolated_map_position | II | 3.43913 | ||||
Reference | WBPaper00001835 | ||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
Method | Substitution_allele |