WormBase Tree Display for Variation: WBVar00242713
expand all nodes | collapse all nodes | view schema
WBVar00242713 | Name | Public_name | sc108 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C01B12.1.1:c.232C>T | |||||||
CE07789:p.Arg78Cys | ||||||||
HGVSg | CHROMOSOME_II:g.23630C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | C01B12 | ||||
Flanking_sequences | gatggaccacacctattccatcgtcagaag | gtcaatactcttcaccaaacccaccagctg | ||||||
Mapping_target | C01B12 | |||||||
Type_of_mutation | Substitution | c | t | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00003807 | |||||||
Laboratory | BE | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00005017 | ||||||
Transcript | C01B12.1.1 (12) | |||||||
Interactor | WBInteraction000052488 | |||||||
WBInteraction000052559 | ||||||||
WBInteraction000052561 | ||||||||
WBInteraction000052562 | ||||||||
WBInteraction000052574 | ||||||||
WBInteraction000537324 | ||||||||
Genetics | Interpolated_map_position | II | -18.0003 | |||||
Description | Phenotype | WBPhenotype:0000502 | Paper_evidence | WBPaper00000906 | ||||
Curator_confirmed | WBPerson712 | |||||||
Dominant | Paper_evidence | WBPaper00000906 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000519 | Paper_evidence | WBPaper00033444 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutant strains tested showed altered fitness compared to wild type when exposed to different bacterial environments such as E. coli, M. luteus, and Pseudomonas sp.and B. megaterium | Paper_evidence | WBPaper00033444 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors report "medium dpy" (Table 1) | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors report "severe disruption with branching" (Table 1) | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors report "severe disruption" (Table 1) | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00005747 | |||||||
WBPaper00033444 | ||||||||
WBPaper00000906 | ||||||||
WBPaper00032171 | ||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00005017 Missense 78 R to C | |||||||
Method | Substitution_allele |