WormBase Tree Display for Variation: WBVar00242712
expand all nodes | collapse all nodes | view schema
| WBVar00242712 | Evidence | Paper_evidence | WBPaper00001835 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | sc107 | |||||
| Other_name | B0491.2.2:c.407G>A | ||||||
| B0491.2.1:c.407G>A | |||||||
| CE02104:p.Gly136Glu | |||||||
| HGVSg | CHROMOSOME_II:g.11337296C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | B0491 | |||
| Flanking_sequences | gctggaccatccggaccaaagggagttccag | agttccaggactcgacggagttccaggactt | |||||
| Mapping_target | B0491 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001835 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00003806 | ||||||
| Laboratory | BE | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00005016 | |||||
| Transcript | B0491.2.2 (12) | ||||||
| B0491.2.1 (12) | |||||||
| Genetics | Interpolated_map_position | II | 3.43999 | ||||
| Description | Phenotype_not_observed | WBPhenotype:0000886 | Paper_evidence | WBPaper00000906 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Pseudo wild-type; suppresses dominant phenotype of e1350. | Paper_evidence | WBPaper00000906 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00000906 | ||||||
| Method | Substitution_allele |
