WormBase Tree Display for Variation: WBVar00242710
expand all nodes | collapse all nodes | view schema
WBVar00242710 | Evidence | Paper_evidence | WBPaper00001835 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | sc103 | |||||||
Other_name | CE02104:p.Gln48Ter | ||||||||
B0491.2.2:c.142C>T | |||||||||
B0491.2.1:c.142C>T | |||||||||
HGVSg | CHROMOSOME_II:g.11337561G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0491 | |||||
Flanking_sequences | tttgaattttaaataatttttaattttctag | aatctaccaatggattgtggaaggacatagt | |||||||
Mapping_target | B0491 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00001835 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00003804 | ||||||||
WBStrain00005822 | |||||||||
Laboratory | BE | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00005016 | |||||||
Transcript | B0491.2.2 | VEP_consequence | stop_gained,splice_region_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0491.2.2:c.142C>T | ||||||||
HGVSp | CE02104:p.Gln48Ter | ||||||||
cDNA_position | 157 | ||||||||
CDS_position | 142 | ||||||||
Protein_position | 48 | ||||||||
Exon_number | 4/5 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
B0491.2.1 | VEP_consequence | stop_gained,splice_region_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0491.2.1:c.142C>T | ||||||||
HGVSp | CE02104:p.Gln48Ter | ||||||||
cDNA_position | 174 | ||||||||
CDS_position | 142 | ||||||||
Protein_position | 48 | ||||||||
Exon_number | 4/5 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000501830 | ||||||||
Genetics | Interpolated_map_position | II | 3.44065 | ||||||
Description | Phenotype | WBPhenotype:0000501 | Paper_evidence | WBPaper00000906 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Left roller as transheterozygote with sc13 but not sc97, sc99, sc101 or e1350. | Paper_evidence | WBPaper00000906 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00000906 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Dumpy as transheterozyogte with e1350, but not sc97, sc99, sc101 or sc13. Weak dumpy over Df. | Paper_evidence | WBPaper00000906 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000886 | Paper_evidence | WBPaper00000906 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Psuedo wild-type. WT as homozygote and heterozygote. | Paper_evidence | WBPaper00000906 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00027237 | ||||||||
WBPaper00001328 | |||||||||
WBPaper00000906 | |||||||||
Method | Substitution_allele |