WormBase Tree Display for Variation: WBVar00242675

WBVar00242675 Evidence: Person_evidence: WBPerson10095
  Name: Public_name: sc16
    Other_name: CE29928:p.Arg71His
      Y73B6BL.34.1:c.212G>A
    HGVSg: CHROMOSOME_IV:g.6377426G>A
  Sequence_details: SMap: S_parent: Sequence: Y73B6BL
    Flanking_sequences: tcaacgaggtctcctcgatccgttccaacc taccgcccgtcaagcttcttacggagattc
    Mapping_target: Y73B6BL
    Type_of_mutation: Substitution: g a
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain (19)
    Laboratory: BE
    Status: Live
  Affects: Gene: WBGene00000256
    Transcript: Y73B6BL.34.1 (12)
  Genetics: Interpolated_map_position: IV 3.18862
    Mapping_data: In_2_point: 447
        448
      In_multi_point (21)
  Description: Phenotype: WBPhenotype:0000025 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: adult blistered, both head and body; often small blisters. Easy to score (ES3) in an old adult. Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
        Ease_of_scoring: ES3_Easy_to_score: Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
  Reference: WBPaper00021725
    WBPaper00016554
    WBPaper00013734
    WBPaper00016398
    WBPaper00061945
  Remark: Variation information submitted by WBPerson10095 on 2022-02-17_15:53:29 via the Allele submission form. Curator_confirmed: WBPerson51134
    alt_det = g to a mut_det = R71H Person_evidence: WBPerson10095
      Curator_confirmed: WBPerson51134
  Method: Substitution_allele