WormBase Tree Display for Variation: WBVar00242615
expand all nodes | collapse all nodes | view schema
WBVar00242615 | Evidence | Paper_evidence | WBPaper00004406 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | sa734 | ||||||
Other_name | CE05311:p.Gln52Ter | |||||||
C26C6.2.1:c.154C>T | ||||||||
HGVSg | CHROMOSOME_I:g.7522363C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | C26C6 | ||||
Flanking_sequences | aggagaatcaggaaaatcgactattgtaaaa | agatgaagtgagatttttttaaatttctaa | ||||||
Mapping_target | C26C6 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00004406 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00005663 | |||||||
WBStrain00022814 | ||||||||
WBStrain00050175 | ||||||||
Laboratory | JT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001648 | ||||||
Transcript | C26C6.2.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | C26C6.2.1:c.154C>T | |||||||
HGVSp | CE05311:p.Gln52Ter | |||||||
cDNA_position | 248 | |||||||
CDS_position | 154 | |||||||
Protein_position | 52 | |||||||
Exon_number | 2/10 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
Interactor | WBInteraction000052305 | |||||||
WBInteraction000052306 | ||||||||
WBInteraction000501257 | ||||||||
WBInteraction000501270 | ||||||||
WBInteraction000503445 | ||||||||
WBInteraction000518036 | ||||||||
WBInteraction000518668 | ||||||||
Genetics | Interpolated_map_position | I | 2.09868 | |||||
Description | Phenotype (23) | |||||||
Phenotype_not_observed | WBPhenotype:0000273 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit reduced thrashing compared to wild type animals. | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002114 | Paper_evidence | WBPaper00038270 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals do not become paralyzed after 10 minutes of swimming. | Paper_evidence | WBPaper00038270 | |||||
Curator_confirmed | WBPerson712 | |||||||
Disease_info | Models_disease | DOID:0112202 | ||||||
Models_disease_in_annotation | WBDOannot00001099 | |||||||
Reference | WBPaper00038270 | |||||||
WBPaper00043908 | ||||||||
WBPaper00035198 | ||||||||
WBPaper00027739 | ||||||||
WBPaper00004406 | ||||||||
WBPaper00032008 | ||||||||
WBPaper00054194 | ||||||||
WBPaper00065340 | ||||||||
Method | Substitution_allele |