WormBase Tree Display for Variation: WBVar00242564

WBVar00242564 Evidence: Paper_evidence: WBPaper00035158
  Name: Public_name: sa330
    Other_name: F22E12.4b.3:c.112C>T
      F22E12.4a.1:c.112C>T
      F22E12.4b.2:c.112C>T
      CE27755:p.Gln38Ter
      F22E12.4b.1:c.112C>T
      CE38328:p.Gln38Ter
      CE31342:p.Gln38Ter
      F22E12.4d.1:c.112C>T
    HGVSg: CHROMOSOME_V:g.10468980C>T
  Sequence_details: SMap: S_parent: Sequence: F22E12
    Flanking_sequences: agtcaaccatcttcttctacagctgtttta agtgtacatattgtggaagctcgtgcacatc
    Mapping_target: F22E12
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00000635
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: JT
    Status: Live
  Affects: Gene: WBGene00001178
    Transcript: F22E12.4b.3 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F22E12.4b.3:c.112C>T
        HGVSp: CE31342:p.Gln38Ter
        cDNA_position: 112
        CDS_position: 112
        Protein_position: 38
        Exon_number: 2/11
        Codon_change: Cag/Tag
        Amino_acid_change: Q/*
      F22E12.4b.2 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F22E12.4b.2:c.112C>T
        HGVSp: CE31342:p.Gln38Ter
        cDNA_position: 118
        CDS_position: 112
        Protein_position: 38
        Exon_number: 3/9
        Codon_change: Cag/Tag
        Amino_acid_change: Q/*
      F22E12.4a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F22E12.4a.1:c.112C>T
        HGVSp: CE27755:p.Gln38Ter
        cDNA_position: 120
        CDS_position: 112
        Protein_position: 38
        Exon_number: 3/12
        Codon_change: Cag/Tag
        Amino_acid_change: Q/*
      F22E12.4b.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F22E12.4b.1:c.112C>T
        HGVSp: CE31342:p.Gln38Ter
        cDNA_position: 120
        CDS_position: 112
        Protein_position: 38
        Exon_number: 3/11
        Codon_change: Cag/Tag
        Amino_acid_change: Q/*
      F22E12.4d.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F22E12.4d.1:c.112C>T
        HGVSp: CE38328:p.Gln38Ter
        cDNA_position: 120
        CDS_position: 112
        Protein_position: 38
        Exon_number: 3/11
        Codon_change: Cag/Tag
        Amino_acid_change: Q/*
  Genetics: Interpolated_map_position: V 2.56523
  Description: Phenotype: WBPhenotype:0000011 Paper_evidence: WBPaper00004902
        Curator_confirmed: WBPerson712
        Remark: When exposed to 1 mol of cyanide gas (HCN) in a sealed chamber, wild-type worms exhibited a gradual slowing of movement, and more than 85% of the worms became fully immobile and unresponsive to touch by 5 h after exposure began. By 10 h all of the worms were immobile and unresponsive. In contrast, although mutant egl-9 worms exhibited a sluggishness similar to that of wild-type worms soon after cyanide exposure began, they recovered completely within a few hours and remained fully viable. Exposure to an increased amount of cyanide (4 mol) killed both egl-9 and wild-type worms with indistinguishable kinetics Paper_evidence: WBPaper00004902
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00004572 Paper_evidence: WBPaper00004902
              Curator_confirmed: WBPerson712
      WBPhenotype:0000135 Paper_evidence: WBPaper00035158
        Curator_confirmed: WBPerson2021
        Remark: egl-9 mutation caused over-expression of Pnhr-57::GFP Paper_evidence: WBPaper00035158
            Curator_confirmed: WBPerson2021
        Phenotype_assay: Genotype: nhr-57p::GFP Paper_evidence: WBPaper00035158
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001014 Paper_evidence: WBPaper00003860
        Curator_confirmed: WBPerson712
        Remark: Animals are resistant to paralysis by infection with P. aeruginosa PAO1. Paper_evidence: WBPaper00003860
            Curator_confirmed: WBPerson712
        Rescued_by_transgene: WBTransgene00019769
          WBTransgene00019768
          WBTransgene00019767
      WBPhenotype:0001645 Paper_evidence: WBPaper00035158
        Curator_confirmed: WBPerson2021
        Remark: egl-9 allele severely disabled oxygen-dependent degradation of HIF-1 Paper_evidence: WBPaper00035158
            Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: Western blots Paper_evidence: WBPaper00035158
              Curator_confirmed: WBPerson2021
    Phenotype_not_observed: WBPhenotype:0000006 Paper_evidence: WBPaper00035158
        Curator_confirmed: WBPerson2021
        Remark: sa330 did not cause egg-laying defects Paper_evidence: WBPaper00035158
            Curator_confirmed: WBPerson2021
  Reference: WBPaper00003860
    WBPaper00035158
    WBPaper00004902
  Method: Substitution_allele