WormBase Tree Display for Variation: WBVar00242511
expand all nodes | collapse all nodes | view schema
WBVar00242511 | Evidence | Paper_evidence | WBPaper00005807 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | sa191 | |||||||
Other_name | Y116F11B.1.1:c.109C>T | ||||||||
CE25720:p.Arg37Cys | |||||||||
Y116F11B.1.2:c.109C>T | |||||||||
HGVSg | CHROMOSOME_V:g.19815553C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y116F11B | |||||
Flanking_sequences | gccaacttcaaggccgagggcccactaagc | gtgcagtccgtgttccaggtgtggccgtga | |||||||
Mapping_target | Y116F11B | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00022782 | ||||||||
Laboratory | JT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000920 | |||||||
Transcript | Y116F11B.1.2 (12) | ||||||||
Y116F11B.1.1 (12) | |||||||||
Interactor | WBInteraction000500208 | ||||||||
WBInteraction000500209 | |||||||||
WBInteraction000500211 | |||||||||
WBInteraction000500212 | |||||||||
WBInteraction000500213 | |||||||||
WBInteraction000500214 | |||||||||
WBInteraction000500215 | |||||||||
WBInteraction000501854 | |||||||||
WBInteraction000504688 | |||||||||
WBInteraction000520855 | |||||||||
Genetics | Interpolated_map_position | V | 23.5302 | ||||||
Mapping_data | In_multi_point | 2825 | |||||||
In_pos_neg_data | 7416 | ||||||||
Description | Phenotype | WBPhenotype:0000012 | Paper_evidence | WBPaper00001923 | |||||
WBPaper00044570 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2292 | |||||||||
Remark | Some low level Dauer formation at 15C (8.1%)(n=533), 99% Dauer formation at 25C (n=418). ozDf2/+ animals are not Daf-c; all sa191/ozDf2 are Daf-c; 10% sa191/+ are Daf-c. | Paper_evidence | WBPaper00001923 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
constitutive dauer formation; dauer larvae resume development within 2 hours, even at 25C. Semidominant: 10% of sa191/+ animals form dauers. Probable gf mutation. | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00001923 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00001923 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00001923 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000306 | Paper_evidence | WBPaper00038115 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Levels of trx-1 are increased significantly more than that observed in wild type dauer larvae as assayed by the average relative intensity of fluorescence of ofEx379[Ptrx-1::GFP; Pelt-2::mCherry]. | Paper_evidence | WBPaper00038115 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000032 | PATO:0000460 | Paper_evidence | WBPaper00038115 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000308 | Paper_evidence | WBPaper00001923 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Dauers recover within 2 hrs, even at 25C. | Paper_evidence | WBPaper00001923 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000964 | Paper_evidence | WBPaper00037649 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | partially resistant | Paper_evidence | WBPaper00037649 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0002212 | Paper_evidence | WBPaper00001923 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00038115 | ||||||||
WBPaper00021929 | |||||||||
WBPaper00002485 | |||||||||
WBPaper00001923 | |||||||||
WBPaper00037649 | |||||||||
WBPaper00012298 | |||||||||
WBPaper00014659 | |||||||||
WBPaper00044570 | |||||||||
Method | Substitution_allele |