WormBase Tree Display for Variation: WBVar00242057
expand all nodes | collapse all nodes | view schema
WBVar00242057 | Evidence | Paper_evidence | WBPaper00004214 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | s1451 | |||||
Other_name (12) | |||||||
HGVSg | CHROMOSOME_V:g.7976834_7976837delinsTATC | ||||||
Sequence_details | SMap | S_parent | Sequence | F26D11 | |||
Flanking_sequences | ttctccgaacaattcctctgtcgattgtgg | gagaaaacttgaagagctcgatcttggaca | |||||
Mapping_target | F26D11 | ||||||
Type_of_mutation | Substitution | aatt | gata | Paper_evidence | WBPaper00004214 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | BC | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00002632 | |||||
Transcript (6) | |||||||
Genetics | Interpolated_map_position | V | 0.998962 | ||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00001474 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | egg lethal | Paper_evidence | WBPaper00001474 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00001474 | ||||||
WBPaper00004214 | |||||||
Remark | Flanking sequences are 30 bp to the left and right of nt 30184/30187, respectively | Curator_confirmed | WBPerson1845 | ||||
Method | Substitution_allele |