WormBase Tree Display for Variation: WBVar00241973
expand all nodes | collapse all nodes | view schema
| WBVar00241973 | Evidence | Paper_evidence | WBPaper00006052 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | s1198 | |||||||
| Other_name | CE07224:p.Trp278Ter | ||||||||
| F42A9.2.1:c.833G>A | |||||||||
| HGVSg | CHROMOSOME_IV:g.8622032G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F42A9 | |||||
| Flanking_sequences | agagatgggttcatgttctctgtgtcattt | ggtcgatgaaacacattttggaaatacaatt | |||||||
| Mapping_target | F42A9 | ||||||||
| Type_of_mutation | Substitution | g | a | ||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00022840 | ||||||||
| Laboratory | BC | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00003034 | |||||||
| Transcript | F42A9.2.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F42A9.2.1:c.833G>A | ||||||||
| HGVSp | CE07224:p.Trp278Ter | ||||||||
| cDNA_position | 912 | ||||||||
| CDS_position | 833 | ||||||||
| Protein_position | 278 | ||||||||
| Exon_number | 5/12 | ||||||||
| Codon_change | tGg/tAg | ||||||||
| Amino_acid_change | W/* | ||||||||
| Genetics | Interpolated_map_position | IV | 3.91666 | ||||||
| Description | Phenotype | WBPhenotype:0000057 | Paper_evidence | WBPaper00003719 | |||||
| Person_evidence | WBPerson1847 | ||||||||
| Curator_confirmed | WBPerson48 | ||||||||
| Remark | nonconditional early larval lethal | Paper_evidence | WBPaper00003719 | ||||||
| Person_evidence | WBPerson1847 | ||||||||
| Curator_confirmed | WBPerson48 | ||||||||
| WBPhenotype:0000116 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Stronger than sy238; mid larval lethal. | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000117 | Paper_evidence | WBPaper00006052 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | late L1 lethality | Paper_evidence | WBPaper00006052 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Recessive | Paper_evidence | WBPaper00006052 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Null | Paper_evidence | WBPaper00006052 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | ASE asymmetry is disrupted (as seen with lim-6, gcy-5 and gcy-7 reporters). 2 ASER | Paper_evidence | WBPaper00006052 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | High | Paper_evidence | WBPaper00006052 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Recessive | Paper_evidence | WBPaper00006052 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Null | Paper_evidence | WBPaper00006052 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005663 | PATO:0000460 | Paper_evidence | WBPaper00006052 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00006052 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Genotype | otIs6, otIs114,otIs3, ntIs1 | Paper_evidence | WBPaper00006052 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00006052 | ||||||||
| WBPaper00003719 | |||||||||
| WBPaper00015109 | |||||||||
| Method | Substitution_allele |
