WormBase Tree Display for Variation: WBVar00241753
expand all nodes | collapse all nodes | view schema
| WBVar00241753 | Evidence | Paper_evidence | WBPaper00048558 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | s180 | |||||
| Other_name | s155 | Paper_evidence | WBPaper00000321 | ||||
| CE33587:p.Gln29Ter | |||||||
| Y18H1A.7a.1:c.85C>T | |||||||
| HGVSg | CHROMOSOME_I:g.719551G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | Y18H1A | |||
| Flanking_sequences | cgccgatttatcgccagccggccagttatc | agttcgatcggcgaccaggatacgttccga | |||||
| Mapping_target | Y18H1A | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00048558 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain (22) | |||||||
| Laboratory | BC | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00004332 | |||||
| Transcript | Y18H1A.7a.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | Y18H1A.7a.1:c.85C>T | ||||||
| HGVSp | CE33587:p.Gln29Ter | ||||||
| cDNA_position | 345 | ||||||
| CDS_position | 85 | ||||||
| Protein_position | 29 | ||||||
| Exon_number | 3/7 | ||||||
| Codon_change | Cag/Tag | ||||||
| Amino_acid_change | Q/* | ||||||
| Genetics | Interpolated_map_position | I | -18.5548 | ||||
| Description | Phenotype | WBPhenotype:0000436 | Paper_evidence | WBPaper00032296 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Seven out of sixteen synapsed homolog pairs showed a ZHP-3 focus near the center of the chromosome, in contrast to four of five synapsed homolog pairs in wild-type animals with a ZHP-3 focus closer to one end. | Paper_evidence | WBPaper00032296 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000742 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | increases meiotic recombination in gene clusters, reduces recombination on chromosome arms; distribution of crossovers in Rec-1 approximates physical map. | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Phenotype_not_observed (2) | |||||||
| Reference | WBPaper00000565 | ||||||
| WBPaper00016442 | |||||||
| WBPaper00032296 | |||||||
| WBPaper00048558 | |||||||
| Method | Substitution_allele |
