WormBase Tree Display for Variation: WBVar00241532
expand all nodes | collapse all nodes | view schema
WBVar00241532 | Evidence | Paper_evidence | WBPaper00026842 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | rh80 | |||||||
Other_name | CE25673:p.Trp893Ter | ||||||||
CE32767:p.Trp883Ter | |||||||||
CE28273:p.Trp907Ter | |||||||||
CE25672:p.Trp898Ter | |||||||||
ZC504.4a.1:c.2694G>A | |||||||||
ZC504.4d.1:c.2649G>A | |||||||||
ZC504.4b.1:c.2679G>A | |||||||||
ZC504.4c.1:c.2721G>A | |||||||||
HGVSg | CHROMOSOME_X:g.10423132C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZC504 | |||||
Flanking_sequences | tctagagtcgtcaattgagatttatgcgtg | gcaccgaagccataccataagttcatgagt | |||||||
Mapping_target | ZC504 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00026842 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00024148 | ||||||||
WBStrain00028841 | |||||||||
Laboratory | NJ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003247 | |||||||
Transcript | ZC504.4d.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC504.4d.1:c.2649G>A | ||||||||
HGVSp | CE32767:p.Trp883Ter | ||||||||
cDNA_position | 2732 | ||||||||
CDS_position | 2649 | ||||||||
Protein_position | 883 | ||||||||
Exon_number | 14/18 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
ZC504.4a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC504.4a.1:c.2694G>A | ||||||||
HGVSp | CE25672:p.Trp898Ter | ||||||||
cDNA_position | 2770 | ||||||||
CDS_position | 2694 | ||||||||
Protein_position | 898 | ||||||||
Exon_number | 13/17 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
ZC504.4c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC504.4c.1:c.2721G>A | ||||||||
HGVSp | CE28273:p.Trp907Ter | ||||||||
cDNA_position | 2721 | ||||||||
CDS_position | 2721 | ||||||||
Protein_position | 907 | ||||||||
Exon_number | 13/17 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
ZC504.4b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC504.4b.1:c.2679G>A | ||||||||
HGVSp | CE25673:p.Trp893Ter | ||||||||
cDNA_position | 2755 | ||||||||
CDS_position | 2679 | ||||||||
Protein_position | 893 | ||||||||
Exon_number | 13/17 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
Genetics | Interpolated_map_position | X | 2.1894 | ||||||
Description | Phenotype | WBPhenotype:0000016 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007833 | PATO:0001549 | Paper_evidence | WBPaper00035198 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000680 | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited wild type-sensitivities to aldicarb. | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Disease_info | Models_disease | DOID:1826 | |||||||
Models_disease_in_annotation | WBDOannot00000551 | ||||||||
Reference | WBPaper00035198 | ||||||||
WBPaper00026842 | |||||||||
WBPaper00032247 | |||||||||
Method | Substitution_allele |