WormBase Tree Display for Variation: WBVar00241517
expand all nodes | collapse all nodes | view schema
| WBVar00241517 | Evidence | Paper_evidence | WBPaper00035146 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | rh46 | |||||||
| Other_name | F41C6.1.1:c.469G>C | ||||||||
| F41C6.1.2:c.469G>C | |||||||||
| CE04538:p.Ala157Pro | |||||||||
| HGVSg | CHROMOSOME_X:g.6890708G>C | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F41C6 | |||||
| Flanking_sequences | gcacttctgttcccgtctcccagattcaatg | cactttacaagtctgctgactttggaaagac | |||||||
| Mapping_target | F41C6 | ||||||||
| Type_of_mutation | Substitution | g | c | Paper_evidence | WBPaper00035146 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain (21) | |||||||||
| Laboratory | NJ | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00006746 | |||||||
| Transcript | F41C6.1.1 (12) | ||||||||
| F41C6.1.2 (12) | |||||||||
| Interactor | WBInteraction000500102 | ||||||||
| WBInteraction000500103 | |||||||||
| WBInteraction000500104 | |||||||||
| WBInteraction000500105 | |||||||||
| WBInteraction000500107 | |||||||||
| WBInteraction000500170 | |||||||||
| WBInteraction000500171 | |||||||||
| WBInteraction000500172 | |||||||||
| WBInteraction000500173 | |||||||||
| WBInteraction000500174 | |||||||||
| WBInteraction000500175 | |||||||||
| WBInteraction000500178 | |||||||||
| WBInteraction000500180 | |||||||||
| WBInteraction000500181 | |||||||||
| WBInteraction000500182 | |||||||||
| WBInteraction000500184 | |||||||||
| WBInteraction000500185 | |||||||||
| WBInteraction000500186 | |||||||||
| WBInteraction000500187 | |||||||||
| WBInteraction000500188 | |||||||||
| WBInteraction000500191 | |||||||||
| WBInteraction000500926 | |||||||||
| WBInteraction000500927 | |||||||||
| WBInteraction000500930 | |||||||||
| WBInteraction000500931 | |||||||||
| WBInteraction000500932 | |||||||||
| WBInteraction000500934 | |||||||||
| WBInteraction000500935 | |||||||||
| WBInteraction000504804 | |||||||||
| WBInteraction000517247 | |||||||||
| WBInteraction000517248 | |||||||||
| Genetics | Interpolated_map_position | X | -2.09889 | ||||||
| Description | Phenotype | WBPhenotype:0000104 | Paper_evidence | WBPaper00035146 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | UNC-40::GFP is not asymmetrically localized like WT but is more equally distributed across the HSN surface. | Paper_evidence | WBPaper00035146 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000384 | Paper_evidence | WBPaper00035146 | |||||||
| WBPaper00031828 | |||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | AVM axons migrate anteriorly and HSN axons migrate in a number of aberrant patterns. These defects are more pronounced at 20 deg C versus 15 deg C. | Paper_evidence | WBPaper00035146 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Animals exhibit dorsal guidance defects. | Paper_evidence | WBPaper00031828 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Loss of unc-6 function results in 40% failure of ALM ventral outgrowth. | Paper_evidence | WBPaper00031828 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035146 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00035146 | ||||
| WBPaper00031828 | |||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00035146 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBbt:0005274 | PATO:0000460 | Paper_evidence | WBPaper00031828 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBbt:0005278 | PATO:0000460 | Paper_evidence | WBPaper00031828 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00035146 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000541 | Paper_evidence | WBPaper00035146 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | In unc-6 mutants, 80% of the DA and DB motor axons fail to reach the dorsal cord at 20C. | Paper_evidence | WBPaper00035146 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035146 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005274 | PATO:0000460 | Paper_evidence | WBPaper00035146 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBbt:0005278 | PATO:0000460 | Paper_evidence | WBPaper00035146 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00035146 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000679 | Paper_evidence | WBPaper00035146 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | UNC-40::GFP is globally localized unlike in wild type animals, and in HSN is evenly distributed along the surface rather than asymmetrically localized. | Paper_evidence | WBPaper00035146 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00019344 | ||||||||
| WBPaper00031828 | |||||||||
| WBPaper00035146 | |||||||||
| WBPaper00010791 | |||||||||
| WBPaper00026240 | |||||||||
| WBPaper00025961 | |||||||||
| Method | Substitution_allele |
