WormBase Tree Display for Variation: WBVar00241515
expand all nodes | collapse all nodes | view schema
WBVar00241515 | Evidence | Paper_evidence | WBPaper00003027 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | rh40 | |||||||
Other_name | F55C7.7i.1:c.3647C>T | ||||||||
F55C7.7b.1:c.3647C>T | |||||||||
CE36937:p.Ser1216Phe | |||||||||
F55C7.7a.1:c.3647C>T | |||||||||
F55C7.7i.2:c.3647C>T | |||||||||
CE19465:p.Ser1216Phe | |||||||||
CE19464:p.Ser1216Phe | |||||||||
HGVSg | CHROMOSOME_I:g.4022591G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F55C7 | |||||
Flanking_sequences | tgcttgagccaatgcgagagcttattcaat | cgaacgggattatatcaaagatctcgagaga | |||||||
Mapping_target | F55C7 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003027 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00024129 | ||||||||
WBStrain00024156 | |||||||||
WBStrain00024163 | |||||||||
Laboratory | NJ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006805 | |||||||
Transcript | F55C7.7i.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
HGVSc | F55C7.7i.1:c.3647C>T | ||||||||
HGVSp | CE36937:p.Ser1216Phe | ||||||||
cDNA_position | 3647 | ||||||||
CDS_position | 3647 | ||||||||
Protein_position | 1216 | ||||||||
Exon_number | 14/26 | ||||||||
Codon_change | tCc/tTc | ||||||||
Amino_acid_change | S/F | ||||||||
F55C7.7b.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
HGVSc | F55C7.7b.1:c.3647C>T | ||||||||
HGVSp | CE19465:p.Ser1216Phe | ||||||||
cDNA_position | 3647 | ||||||||
CDS_position | 3647 | ||||||||
Protein_position | 1216 | ||||||||
Exon_number | 14/21 | ||||||||
Codon_change | tCc/tTc | ||||||||
Amino_acid_change | S/F | ||||||||
F55C7.7a.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
HGVSc | F55C7.7a.1:c.3647C>T | ||||||||
HGVSp | CE19464:p.Ser1216Phe | ||||||||
cDNA_position | 3759 | ||||||||
CDS_position | 3647 | ||||||||
Protein_position | 1216 | ||||||||
Exon_number | 15/34 | ||||||||
Codon_change | tCc/tTc | ||||||||
Amino_acid_change | S/F | ||||||||
F55C7.7i.2 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
HGVSc | F55C7.7i.2:c.3647C>T | ||||||||
HGVSp | CE36937:p.Ser1216Phe | ||||||||
cDNA_position | 3647 | ||||||||
CDS_position | 3647 | ||||||||
Protein_position | 1216 | ||||||||
Exon_number | 14/25 | ||||||||
Codon_change | tCc/tTc | ||||||||
Amino_acid_change | S/F | ||||||||
Interactor | WBInteraction000501033 | ||||||||
WBInteraction000502105 | |||||||||
WBInteraction000503920 | |||||||||
WBInteraction000542211 | |||||||||
WBInteraction000542212 | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | I | -1.85712 | ||||||
Mapping_data | In_2_point | 6045 | |||||||
In_multi_point | 2091 | ||||||||
2097 | |||||||||
Description | Phenotype | WBPhenotype:0000016 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007833 | PATO:0001549 | Paper_evidence | WBPaper00035198 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000232 | Paper_evidence | WBPaper00032941 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | rh40 mutation frequently resulted in defective ALM and CAN migration | Paper_evidence | WBPaper00032941 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006827 | PATO:0000460 | Paper_evidence | WBPaper00032941 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000471 | Paper_evidence | WBPaper00032941 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | rh40 mutation frequently resulted in defective ALM and CAN migration | Paper_evidence | WBPaper00032941 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00032941 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000571 | Paper_evidence | WBPaper00035198 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Synaptic vesicles are misaccumulated in GABAergic D-type motor neurons as assayed by gaps in the pattern of fluorescence of juIs1[Punc-25::SNB-1::GFP] labeled vesicles. | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005190 | PATO:0000460 | Paper_evidence | WBPaper00035198 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000882 | Paper_evidence | WBPaper00056964 | |||||||
Curator_confirmed | WBPerson48777 | ||||||||
Remark | Primary dendrite outgrowth reduced. Fig S2A | Paper_evidence | WBPaper00056964 | ||||||
Curator_confirmed | WBPerson48777 | ||||||||
3° dendrites that fail to self-avoid and overgrow one another. Fig 3C. | Paper_evidence | WBPaper00056964 | |||||||
Curator_confirmed | WBPerson48777 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00056964 | ||||||
Curator_confirmed | WBPerson48777 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006831 | PATO:0000460 | Paper_evidence | WBPaper00056964 | ||||
Curator_confirmed | WBPerson48777 | ||||||||
Phenotype_assay | Control_strain | WBStrain00047813 | Paper_evidence | WBPaper00056964 | |||||
Curator_confirmed | WBPerson48777 | ||||||||
Genotype | wdIs52 (pF49H12.4::GFP) | Paper_evidence | WBPaper00056964 | ||||||
Curator_confirmed | WBPerson48777 | ||||||||
WBPhenotype:0000944 | Paper_evidence | WBPaper00049729 | |||||||
Curator_confirmed | WBPerson24243 | ||||||||
Remark | Figure 1, PLM anterior neurite was shortened in the mutants in the mutants. | Paper_evidence | WBPaper00049729 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00049729 | ||||
Curator_confirmed | WBPerson24243 | ||||||||
GO_term | GO:0043005 | PATO:0002364 | Paper_evidence | WBPaper00049729 | |||||
Curator_confirmed | WBPerson24243 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00032941 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Quantification of the amount of SAX-3::GFP in ALMs and BDUs cells revealed that the levels appeared to be lower in embryos that contained the unc-73 mutation | Paper_evidence | WBPaper00032941 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00032941 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0006826 | PATO:0000460 | Paper_evidence | WBPaper00032941 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | gmIs28 [Pmec- 7::sax-3::gfp] | Paper_evidence | WBPaper00032941 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002259 | Paper_evidence | WBPaper00056964 | |||||||
Curator_confirmed | WBPerson48777 | ||||||||
Remark | Reduced number of secondary dendrites. Fig S2B. | Paper_evidence | WBPaper00056964 | ||||||
Curator_confirmed | WBPerson48777 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00056964 | ||||||
Curator_confirmed | WBPerson48777 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006831 | PATO:0000460 | Paper_evidence | WBPaper00056964 | ||||
Curator_confirmed | WBPerson48777 | ||||||||
Phenotype_assay | Control_strain | WBStrain00047813 | Paper_evidence | WBPaper00056964 | |||||
Curator_confirmed | WBPerson48777 | ||||||||
Genotype | wdIs52 (pF49H12.4::GFP) | Paper_evidence | WBPaper00056964 | ||||||
Curator_confirmed | WBPerson48777 | ||||||||
Disease_info | Models_disease | DOID:1826 | |||||||
Models_disease_in_annotation | WBDOannot00000554 | ||||||||
Reference | WBPaper00035198 | ||||||||
WBPaper00014129 | |||||||||
WBPaper00032941 | |||||||||
WBPaper00017425 | |||||||||
WBPaper00023401 | |||||||||
WBPaper00023679 | |||||||||
WBPaper00022729 | |||||||||
WBPaper00049729 | |||||||||
WBPaper00056964 | |||||||||
Method | Substitution_allele |