WormBase Tree Display for Variation: WBVar00241459

WBVar00241459 Evidence: Paper_evidence: WBPaper00003389
  Name: Public_name: r1197
    Other_name: CE25584:p.Leu204Ter
      Y73B6A.4.1:c.611T>A
    HGVSg: CHROMOSOME_IV:g.6741524A>T
  Sequence_details: SMap: S_parent: Sequence: Y73B6A
    Flanking_sequences: cgatttgcaaaatttttgaaaatattcgtt agccaccagaagcagttgggaattccatag
    Mapping_target: Y73B6A
    Type_of_mutation: Substitution: a t Curator_confirmed: WBPerson4055
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00034952
    Laboratory: TR
    Status: Live
  Affects: Gene: WBGene00004885
    Transcript: Y73B6A.4.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: Y73B6A.4.1:c.611T>A
        HGVSp: CE25584:p.Leu204Ter
        cDNA_position: 624
        CDS_position: 611
        Protein_position: 204
        Exon_number: 5/9
        Codon_change: tTa/tAa
        Amino_acid_change: L/*
  Genetics: Interpolated_map_position: IV 3.22051
  Reference: WBPaper00003389
  Remark: Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues.
    [200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand Curator_confirmed: WBPerson4055
  Method: Substitution_allele