WormBase Tree Display for Variation: WBVar00241423
expand all nodes | collapse all nodes | view schema
| WBVar00241423 | Evidence | Paper_evidence | WBPaper00003648 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | r895 | |||||
| Other_name | Y48G8AL.6.1:c.1415G>A | ||||||
| CE28367:p.Gly472Glu | |||||||
| HGVSg | CHROMOSOME_I:g.1180583G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | Y48G8AL | |||
| Flanking_sequences | taagcttgattcaaggacctccgggaactg | aaaaaccgtagtttcggcgacaatcgtcta | |||||
| Mapping_target | Y48G8AL | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003648 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | TR | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00004880 | |||||
| Transcript | Y48G8AL.6.1 (12) | ||||||
| Genetics | Interpolated_map_position | I | -16.9143 | ||||
| Description | Phenotype | WBPhenotype:0001538 | Paper_evidence | WBPaper00001192 | |||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | Isolated as a suppressor of unc-54(r293). This allele exhibits morphological abnormalities in the genitalia | Paper_evidence | WBPaper00001192 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Recessive | Paper_evidence | WBPaper00001192 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| Reference | WBPaper00001192 | ||||||
| Method | Substitution_allele |
