WormBase Tree Display for Variation: WBVar00241309
expand all nodes | collapse all nodes | view schema
WBVar00241309 | Evidence | Paper_evidence | WBPaper00001813 | ||
---|---|---|---|---|---|
Name | Public_name | r293 | |||
HGVSg | CHROMOSOME_I:g.14855889_14856142del | ||||
Sequence_details | SMap | S_parent | Sequence | F32A7 | |
Flanking_sequences | tactcttcaacatccctacatgctctttctc | aaaaaccgcacacaaaataccttatcatatg | |||
Mapping_target | F32A7 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00005380 | ||||
WBStrain00030606 | |||||
WBStrain00030607 | |||||
WBStrain00034942 | |||||
WBStrain00034946 | |||||
WBStrain00034947 | |||||
WBStrain00034948 | |||||
WBStrain00034951 | |||||
WBStrain00034952 | |||||
WBStrain00034953 | |||||
Laboratory | TR | ||||
Status | Live | ||||
Affects | Gene | WBGene00006789 | |||
Transcript | F11C3.3.1 | VEP_consequence | 3_prime_UTR_variant | ||
VEP_impact | MODIFIER | ||||
cDNA_position | 5963-? | ||||
Exon_number | 11/11 | ||||
Interactor (12) | |||||
Genetics | Interpolated_map_position | I | 27.9598 | ||
Reference (17) | |||||
Remark | r293 has a 256bp deletion entirely 3' of the unc-54 OFR. The deleted material includes the 3' cleavage site, the polyadeylation site and most of the 3'UTR. | ||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006789 Genomic_neighbourhood | |||||
Method | Deletion_allele |