WormBase Tree Display for Variation: WBVar00241307
expand all nodes | collapse all nodes | view schema
| WBVar00241307 | Name | Public_name | r274 | ||||
|---|---|---|---|---|---|---|---|
| Other_name | F11C3.3.1:c.2272G>T | ||||||
| CE09349:p.Gly758Ter | |||||||
| HGVSg | CHROMOSOME_I:g.14859956C>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | F11C3 | |||
| Flanking_sequences | cgaggctatcatgtccaagctcgtcaacgac | gatccctcagcgaggagatgttccgtatcgg | |||||
| Mapping_target | F11C3 | ||||||
| Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00001813 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | TR | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006789 | |||||
| Transcript | F11C3.3.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | F11C3.3.1:c.2272G>T | ||||||
| HGVSp | CE09349:p.Gly758Ter | ||||||
| cDNA_position | 2304 | ||||||
| CDS_position | 2272 | ||||||
| Protein_position | 758 | ||||||
| Exon_number | 7/11 | ||||||
| Codon_change | Gga/Tga | ||||||
| Amino_acid_change | G/* | ||||||
| Genetics | Interpolated_map_position | I | 27.9609 | ||||
| Reference | WBPaper00016549 | ||||||
| WBPaper00014397 | |||||||
| Remark | Corrected the original G-A annotation ti be like the published G-T. | Curator_confirmed | WBPerson1983 | ||||
| WARNING: The annotated Glycine (758) does not match the published position (761) so experimental validation is suggested before additional experiments are designed. | Curator_confirmed | WBPerson1983 | |||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006789 Opal_UGA G(758) to stop | |||||||
| Method | Substitution_allele |
