WormBase Tree Display for Variation: WBVar00241132
expand all nodes | collapse all nodes | view schema
WBVar00241132 | Evidence | Person_evidence | WBPerson19575 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | q490 | |||||||
Other_name | CE15998:p.Gln99Ter | ||||||||
F38A6.1c.1:c.10C>T | |||||||||
F38A6.1b.1:c.103C>T | |||||||||
CE40229:p.Gln4Ter | |||||||||
CE40228:p.Gln35Ter | |||||||||
F38A6.1a.1:c.295C>T | |||||||||
HGVSg | CHROMOSOME_V:g.20756922C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F38A6 | |||||
Flanking_sequences | CAATTTTTTTCTTGCAGGCCATGAACGCT | aggactatctgccgacgtattctaatacta | |||||||
Mapping_target | F38A6 | ||||||||
Type_of_mutation | Substitution | C | T | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00022556 | ||||||||
Laboratory | JK | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004013 | |||||||
Transcript | F38A6.1c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F38A6.1c.1:c.10C>T | ||||||||
HGVSp | CE40229:p.Gln4Ter | ||||||||
cDNA_position | 13 | ||||||||
CDS_position | 10 | ||||||||
Protein_position | 4 | ||||||||
Exon_number | 2/8 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
F38A6.1b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F38A6.1b.1:c.103C>T | ||||||||
HGVSp | CE40228:p.Gln35Ter | ||||||||
cDNA_position | 103 | ||||||||
CDS_position | 103 | ||||||||
Protein_position | 35 | ||||||||
Exon_number | 2/7 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
F38A6.1a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F38A6.1a.1:c.295C>T | ||||||||
HGVSp | CE15998:p.Gln99Ter | ||||||||
cDNA_position | 295 | ||||||||
CDS_position | 295 | ||||||||
Protein_position | 99 | ||||||||
Exon_number | 3/9 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000520187 | ||||||||
WBInteraction000555237 | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | V | 25.1021 | ||||||
Description | Phenotype | WBPhenotype:0000242 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | most embryos fail to elongate | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000347 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | some rectal cells often missing | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005773 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000617 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | intestine not connected to rectum | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005772 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005773 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000675 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | zygotic lethal, q490/Df similar | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000867 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | embryonic arrest with no pharynx | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001646 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | no pharynx | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001689 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | absence of pharyngeal antigens | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005459 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000961 | Paper_evidence | WBPaper00003331 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The pha-4(q490) mutation did not affect the expression of transgenic ges-1(delta B) in the embryonic anterior gut (Figure 5b). | Paper_evidence | WBPaper00003331 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | ges-1(delta B)::lacZ | Paper_evidence | WBPaper00003331 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00003331 | ||||||||
WBPaper00022417 | |||||||||
WBPaper00011730 | |||||||||
WBPaper00003134 | |||||||||
Remark | reported in Horner et al., 1998 | Paper_evidence | WBPaper00003134 | ||||||
Person_evidence | WBPerson19575 | ||||||||
Curator_confirmed | WBPerson51134 | ||||||||
Variation information submitted by WBPerson19575 on 2022-04-29_08:27:18 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||||||
alt_det = C->T mut_det = gln99->Stop | Paper_evidence | WBPaper00003134 | |||||||
Person_evidence | WBPerson19575 | ||||||||
Curator_confirmed | WBPerson51134 | ||||||||
Method | Substitution_allele |