WormBase Tree Display for Variation: WBVar00241110
expand all nodes | collapse all nodes | view schema
WBVar00241110 | Evidence | Paper_evidence | WBPaper00002046 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | q420 | |||||||
Other_name | Y73C8B.4.1:c.725-1G>A | ||||||||
HGVSg | CHROMOSOME_V:g.3189356G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y73C8B | |||||
Flanking_sequences | agagtctagacatgagaatttgttttttca | gcgccaaatgcttcccaaacggtccgaaag | |||||||
Mapping_target | Y73C8B | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002046 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00022546 | ||||||||
Laboratory | JK | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002246 | |||||||
Transcript | Y73C8B.4.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y73C8B.4.1:c.725-1G>A | ||||||||
Intron_number | 3/4 | ||||||||
Interactor | WBInteraction000521259 | ||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00002046 | |||||
Genetics | Interpolated_map_position | V | -12.7104 | ||||||
Description | Phenotype (15) | ||||||||
Phenotype_not_observed | WBPhenotype:0000594 | Paper_evidence | WBPaper00004662 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We also observed the migration of P11/12 in a lag-2 mutant. LAG-2 is one of the four C_elegans homologs of the Delta protein, which is the ligand of Notch in Drosophila (Henderson et_al, 1994; Tax et_al, 1994). P11/12 migration is not clearly affected in this temperature-sensitive hypomorphic allele, although the bias in orientation may be reduced (Table 1C)." | Paper_evidence | WBPaper00004662 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004409 | PATO:0000460 | Paper_evidence | WBPaper00004662 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (7) | |||||||||
Method | Substitution_allele |