WormBase Tree Display for Variation: WBVar00241103
expand all nodes | collapse all nodes | view schema
WBVar00241103 | Evidence | Paper_evidence | WBPaper00003546 | ||||||
---|---|---|---|---|---|---|---|---|---|
WBPaper00002046 | |||||||||
Name | Public_name | q393 | |||||||
Other_name | Y73C8B.4.1:c.470G>A | ||||||||
CE22970:p.Cys157Tyr | |||||||||
HGVSg | CHROMOSOME_V:g.3188819G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y73C8B | |||||
Flanking_sequences | aaagatgcgacgccatgggacgtctccgct | tgacatcggatggatgggaccacattgtgg | |||||||
Mapping_target | Y73C8B | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003546 | ||||
WBPaper00002046 | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | JK | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002246 | |||||||
Transcript | Y73C8B.4.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0 | deleterious | |||||||
PolyPhen | 1 | probably_damaging | |||||||
HGVSc | Y73C8B.4.1:c.470G>A | ||||||||
HGVSp | CE22970:p.Cys157Tyr | ||||||||
cDNA_position | 477 | ||||||||
CDS_position | 470 | ||||||||
Protein_position | 157 | ||||||||
Exon_number | 2/5 | ||||||||
Codon_change | tGt/tAt | ||||||||
Amino_acid_change | C/Y | ||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00002046 | |||||
Genetics | Interpolated_map_position | V | -12.7116 | ||||||
Description | Phenotype | WBPhenotype:0000094 | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Anus is absent. A protrusion is present at the normal location of the anal opening | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | 92 percent of L1 lethals lack both the excretory cell and rectum/anus. 8 percent of L1 lethals lack either the excretory cell and rectum/anus | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005364 | PATO:0000460 | Paper_evidence | WBPaper00001423 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000117 | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001423 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000621 | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | There is no detectable excretory cell or excretory duct and a small protrusion is present at the normal location of the excretory pore | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | 92 percent of L1 lethals lack both the excretory cell and rectum/anus. 8 percent of L1 lethals lack either the excretory cell and rectum/anus | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005812 | PATO:0000460 | Paper_evidence | WBPaper00001423 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005777 | PATO:0000460 | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001098 | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The rectum is undetectable | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | 92 percent of L1 lethals lack both the excretory cell and rectum/anus. 8 percent of L1 lethals lack either the excretory cell and rectum/anus | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005773 | PATO:0000460 | Paper_evidence | WBPaper00001423 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001099 | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | 4 percent of L1 lethals have a twisted nose | Paper_evidence | WBPaper00001423 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001423 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001423 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001423 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00001423 | ||||||||
WBPaper00002046 | |||||||||
WBPaper00003546 | |||||||||
Method | Substitution_allele |